SGN Marker T0683

SGN-M1541
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: TMEAI38TH
Arabidopsis best BAC match: AL110123.1
Arabidopsis position: 4.0950000
Arabidopsis identities: 0.877
Best GenBank protein hit: CAB78812.1
Evalue: 2.0e-59
Identities: 0.887
Description: ribosomal protein L32-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39391)
Chromosome
2
Position
39.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0683 was used as an overgo probe on plate 11 [well H7]

Plausible BAC Matches:   P264O21,   P143I08,   P324L15,   P160F05,   P324C09

 Overgo Sequences

A sequence
GATACGGGTCAGACAAGAAGACTC
B sequence
TTGGGAAGATAGTGGCGAGTCTTC
AB sequence
GATACGGGTCAGACAAGAAGACTCGCCACT
Marker sequence
CAGCAGAAACCCTAGTTCCAAAGGTAAGACAAGGTAGAACAACAACAATG
GCCGTGCCTCTGCTTAACAAGAAGGTCGTGAAGAAGAGAGTGAAGAGGTT
CATTAGACCTCAGAGTGACCGAAGAATCACTGTTAAGGAAAGCTGGCGCA
GACCCAAGGGTATTGATTCTAGAGTGAGGAGAAAGTTCAAGGGATGTGTC
TTGATGCCCAATATTGGATACGGGTCAGACAAGAAGACTCGCCACTATCT
TCCCAATGGCTTCAAGAAGTTCGTTGTGCATAATGCTAGCGAGCTTGAGA
TCCTAATGATGCACAACAGAACTTACTGTGCAGAAATCGCACACAATGTT
TCCACTAGGAAGAGGAAAGAGATTGTCGAGCGAGCTGCCCAACTTGATGT
TGTCATAACAAACAAGCTTGCTAGGTTGCACAGTCAGGAGGATGAATGAG
CATTTTGGCTTTAGATGAGATCTCTATATTGTTTTAGTGCTTGAACCTGT
TCCTTTTGGTTTGTTTAATTAATACTCTGGTTTCCCGAAGTGGATTTTGA
CACATTCTATTGCTATCAAATGCTTAAATTT
Genomic location of T0683  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1541 marker 1541
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)