SGN Marker T0688

SGN-M1544
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMECX36TH
Arabidopsis best BAC match: AC005916.2
Arabidopsis position: 1.0610000
Arabidopsis identities: 0.887
Best GenBank protein hit: AAD45991.1
Evalue: 1.1e-44
Identities: 0.897
Description: "Similar to gb|AF151884 CGI-126 protein from Homo sapiens. [Arabidopsis thaliana]/ 2nd, e-27, CG8386 gene product [Drosophila melanogaster]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39851)
Chromosome
4
Position
89.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0688 was used as an overgo probe on plate 7 [well C5]

Plausible BAC Matches:   P275E04,   P295L16,   P182E16,   P024G23

 Overgo Sequences

A sequence
GGTTCCGTATATCTGCGGCTAATC
B sequence
CAACGAGTACCTTCAGGATTAGCC
AB sequence
GGTTCCGTATATCTGCGGCTAATCCTGAAG
Marker sequence
TGCCATTGTTATCAAAATTCTCCTTTAATTCCGAGATGGAGGGTTGGGAT
CCGAGTACCAAAACAACCCTTACACAGATCCCTTTGTTAACAATCAAAGC
TGGTCCACGTGACGGCGCGGCATGGACACAGCGGCTGAAGGAAGAATACA
AGGCTCTAATCGCCTATACATCAATGAACAAATCCAAAGATAATGATTGG
TTCCGTATATCTGCGGCTAATCCTGAAGGTACTCGTTGGAAGGGGAAGTG
TTGGTATGTGCATAACCTTCTCAAGTACGAGTTTGACCTCCAGTTTGATA
Genomic location of T0688  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1544 marker 1544
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)