Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker TGS2379

SGN-M15453

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50862)
Chromosome
4
Position
10.72 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48796)
Chromosome
4
Position
31.33 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45911
Forward primer (5'-3')
GTGAACATGTTTTTGTGCGAGA
Accessions and product sizes
Solanum lycopersicum LA925
107
Approximate temperature
55°C
Reverse primer (5'-3')
CCCAATATGGTGGCCAAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS2379  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15453 marker 15453
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)