SGN Marker T0697

SGN-M1548
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TMECW96TV
Arabidopsis best BAC match: AC007654.2
Arabidopsis position: 1.0650000
Arabidopsis identities: 0.888
Best GenBank protein hit: AAA33344.1
Evalue: 1.1e-82
Identities: 0.713
Description: photosystem I subunit III [Flaveria trinervia]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49540)
Chromosome
2
Position
33.92 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47474)
Chromosome
2
Position
42.34 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39394)
Chromosome
2
Position
37.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0697 was used as an overgo probe on plate 11 [well F6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTCTTCCAGCTTCTGCTGACATC
B sequence
AAGGTGTAAGCCCAGAGATGTCAG
AB sequence
GTTCTTCCAGCTTCTGCTGACATCTCTGGG
Marker sequence
TAATACTCTTAGAAAGAACACCATGTCTCTAACTATTCCAACAAGCCTTT
CAAAACCCATTTCCACATCTAAATTTGGGTCTCAATTTACCACAAAACAA
AGAACTTCAGCCATTGTGTGTTGTTCAAACCAAACCCCTGTTTCTAATTC
AACAGAGGAAAGTTCTTCTTCATTAAAGGCATTCTCTGCAGCACTTGCTT
TGTCTTCTATTCTTTTGTCAGCACCAGTTCTTCCAGCTTCTGCTGACATC
TCTGGGCTTACACCTTGCAAGGACTCAAAACAGTTTGCTAAAAGGGAGAA
GCAACAGATCAAGAAGCTTCAAAATTCTTTGAAACTTTATGCACCTGATA
GCGCCCCTGCACTTGCTATCAATGCCACTATTGAGAAAACTAAACGCAGG
TTTGACAACTATGGAAAGCAAGGACTGTTGTGTGGATCAGATGGACTACC
GCATTTGATAGTGAGTGGTGACCAGAGGCACTGGGGTGAGTTCATCACTC
CAGGGATCCTCTTCTTGTACATTGCTGGATGGATTGGATGGGTAGGAAGG
AGTTACTTGATTGCCGTAAGAGATGAAAAGAAACCAACAATGAAGGAGAT
CATCATCGATGTTCCATTGGCTAATAGACTCGTGTGGAGAGGCTTCATCT
GGCCTGTTGCTGCTTACAGAGAGTACTTGAACGGAGACCTTATTGACCCT
AAT
Genomic location of T0697  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1548 marker 1548
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)