SGN Marker TGS2705

SGN-M15504

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50912)
Chromosome
3
Position
14.17 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48847)
Chromosome
3
Position
47.80 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45970
Forward primer (5'-3')
GCCACTAACTCCATGTGAATTGC
Accessions and product sizes
Solanum lycopersicum LA925
266
Approximate temperature
55°C
Reverse primer (5'-3')
TTGGGTTCCTGCATTTGAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS2705  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15504 marker 15504
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)