SGN Marker T0703

SGN-M1551
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMECZ14TH
Arabidopsis best BAC match: AC006569.4
Arabidopsis position: 2.1170000
Arabidopsis identities: 0.730
Best GenBank protein hit: AAD21749.1
Evalue: 4.7e-24
Identities: 0.487
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49542)
Chromosome
4
Position
3.96 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47476)
Chromosome
4
Position
23.74 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42379)
Chromosome
11
Position
115.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39396)
Chromosome
4
Position
25.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10766)
Chromosome
11
Position
120.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0703 was used as an overgo probe on plate 7 [well H2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGGTCCTTGGTACAATGCATCAC
B sequence
TGGTGAGCTACTGCTAGTGATGCA
AB sequence
GAGGTCCTTGGTACAATGCATCACTAGCAG
Marker sequence
CTCACATAAGCAAAATGTTGGGGAGAAGATTTATCTCCTTCTTGCGTCGC
TCTCCATCAGCTTCGGGAAAAGTGGTGGCCGAGGAAGGGAAGGCAAAGAC
ATGGGGGCGAAGGATAGTGTCAGGGACCTTGATTTGCTTAACTGGAGGCG
TTGCTCTAAGTGCTCTTGATGATCTCTCCATATATCATAGCTGCAGCAGC
AAGGCCTTGGAAAGAGCCAGTAAGAACAAGCCGATTATAGATGCCATTGG
CGAGCCCATTGTTAGAGGTCCTTGGTACAATGCATCACTAGCAGTAGCTC
ACCAAAGGCAATCTGTATCATGTACATTTCCTGTCTCTGGACCCCAAGGC
ACCGGAATTTTTCAGCTGAAGGCAGTTCGTAATGGAGAGGACAAATGGTC
ATCATTTTTACGGGCAAGCGACTGGGAGATACTCATTATGGAAGCTCTCG
TCCATGTTCCCGGGGAATG
Genomic location of T0703  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1551 marker 1551
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)