SGN Marker T0706

SGN-M1553
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: None
Arabidopsis best BAC match: AL035601.1
Arabidopsis position: 4.1880000
Arabidopsis identities: 0.900
Best GenBank protein hit: CAB80421.1
Evalue: 3.3e-63
Identities: 0.785
Description: formamidase-like protein [Arabidopsis thaliana]
Comment: amidohydrolase; exact function unclear
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39397)
Chromosome
2
Position
128.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0706 was used as an overgo probe on plate 10 [well F10]

Plausible BAC Matches:   P080H21

 Overgo Sequences

A sequence
CGTTGACACAGATGGAAATCCTGC
B sequence
GAGATCACCTGGTTCAGCAGGATT
AB sequence
CGTTGACACAGATGGAAATCCTGCTGAACC
Marker sequence
GCCATGGCAACAAAAGTTGCCACTCCACAACCGTTGGCACCCAAAAATAC
CTCCTGTGACAGAGATTAAAACAAGGGAGATGTTCCGAATTGAGATGGTT
GATTGGACAGCAAGCTCTATCCAAGATAATAACTCTGCAATTGATGTAAA
AACCGTTGATCTATCCACTGTGCATTATCTCAGTGGGCCAATACGAGTCG
TTGACACAGATGGAAATCCTGCTGAACCAGGTGATCTCCTTGCTGTTGAA
ATATGCAACTTAGGGCCTCTCCCTGGAGATGAATGGGGTTTTACAGCAAT
ATTCGACAGAGAGAACGGTGGAGGATTTCTAACAGACCATTTTCCCCGTG
CAACTAAAGCTATTTGGTATTTCGAAGGCATATATGCCTACTCACCTCAT
ATACCAGGTG
Genomic location of T0706  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1553 marker 1553
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)