SGN Marker T0707

SGN-M1554
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDA27TH
Arabidopsis best BAC match: AB026636.1
Arabidopsis position: 3.0410000
Arabidopsis identities: 0.697
Best GenBank protein hit: BAA94982.1
Evalue: 1.7e-16
Identities: 0.424
Description: contains similarity to O-linked GlcNAc transferase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53147)
Chromosome
4
Position
21.48 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Pepper-COSII   
Map version
58 (location: 41620)
Chromosome
5
Position
34.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43588
Forward primer (5'-3')
TCGTGGATTATGGGCTTCTT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCAAAGTTTTATTGATGATGTTCGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39398)
Chromosome
4
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35592
Forward primer (5'-3')
TCGTGGATTATGGGCTTCTT
Digested band sizes (using ApoI)
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 460
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGTAAGGCTGCAACACATCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 458
Solanum lycopersicum LA925: 458
Approximate temperature
50°C
  
PCR data   Exp. ID 56
Forward primer (5'-3')
Unknown
Digested band sizes (using ApoI)
Solanum lycopersicum LA925: 460
Solanum pennellii LA716: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 458
Solanum pennellii LA716: 458
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
T0707 was used as an overgo probe on plate 1 [well A4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CGTGGATTATGGGCTTCTTAGACG
B sequence
ATCGCTGGGTCAATGACGTCTAAG
AB sequence
CGTGGATTATGGGCTTCTTAGACGTCATTG
Marker sequence
TGAAGTTGTTGATGATGAGTCGTGGATTATGGGCTTCTTAGACGTCATTG
ACCCAGCGATTGACAGCATAAAGAGGCTCTTGAATCTAGATCAGAACTCT
TACTACAAGGTAAAAGAGTCTGCTTCTAATACTACTGCTGGAGACGACGT
TGAGGGGAGCACAGAAGAATCAGCTTCTCCCTCCTCGGCTAACGTCAATG
ACAATAACATAGATACAGGAAGTGGCTTTGATTTAGATGATTTTATCAGT
GTAATGCTGTCTTTAGACCCTTCAAAGCTGGAAGTTCAGCTTACAACATC
TCTTAAGGACCCTCCGAAAATCGCCAGAACTACTAATGGGGTGTGGCGAC
CATCGACAAAGACTAGTAGAACATCAACAACACTTTGATTTTACAACAAC
AACGACATACTTAATGTAACCTCACTAGTGTGGTCTGGGAGGGCGGAGGA
CGAAAGGTGATGTGTTGCAGCCTTACCTTTACCTCGTGAAGGTAGAGAGA
CTGTTTCTGACTCAGCTCAATATGAAG
Genomic location of T0707  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1554 marker 1554
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)