SGN Marker T0708

SGN-M1555
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDB35TH
Arabidopsis best BAC match: AC004401.2
Arabidopsis position: 2.1320000
Arabidopsis identities: 0.950
Best GenBank protein hit: CAA10129.1
Evalue: 1.8e-33
Identities: 0.859
Description: hypothetical protein [Cicer arietinum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49543)
Chromosome
4
Position
60.51 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47477)
Chromosome
4
Position
85.85 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42395)
Chromosome
4
Position
92.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39399)
Chromosome
4
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10776)
Chromosome
4
Position
75.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0708 was used as an overgo probe on plate 7 [well G6]

Plausible BAC Matches:   P204I03,   P325N21

 Overgo Sequences

A sequence
TGCACCACTTCTGAAGTCAAGTGC
B sequence
CCTCAGCATGTTCTCTGCACTTGA
AB sequence
TGCACCACTTCTGAAGTCAAGTGCAGAGAA
Marker sequence
TTTTCCTCCAATTTGTACATTAAATATCTAAGAACAAACTAAGCCATGGG
TGGAGGCAATGGACAGAAGGCAAAGATGGCTCGTGAGAAGAATATGGAAA
AGATGAAAGGCCAAAAGGGAAGCCAGCTTGAGGCTAACAAGAAGGCTATG
AATATCCAGTGCAAGGTGTGCATGCAGACATTCATTTGCACCACTTCTGA
AGTCAAGTGCAGAGAACATGCTGAGGCGAAGCATCCCAAATCTGATGTCT
ATGCATGTTTCCCTCATCTCAAGAAATGATTCACATTTCAGAGTCTGGGC
TGATGGTTGTTTCCCAACTATGTTTCGGGATTCTGTTAACCATGATAAAG
TTTGAATCTGTTCAAAAGTTGTTGCTCCGTTCTGCTTCAAACTGTTGATG
GCACTTAGTTTGGAACTGTGTGAAATATATGTCTATAATAACTGCCTCCT
TTTGGATTG
Genomic location of T0708  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1555 marker 1555
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)