SGN Marker T0720

SGN-M1562
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDB61TH
Arabidopsis best BAC match: AC004484.2
Arabidopsis position: 2.1480000
Arabidopsis identities: 0.505
Best GenBank protein hit: AAC14523.1
Evalue: 1.4e-68
Identities: 0.636
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49545)
Chromosome
8
Position
45.71 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47479)
Chromosome
8
Position
26.37 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39403)
Chromosome
8
Position
20.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0720 was used as an overgo probe on plate 12 [well B10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAAGGCTTTGGCCAAAGAACTGAG
B sequence
AAGTTGTCCCTTGACGCTCAGTTC
AB sequence
CAAGGCTTTGGCCAAAGAACTGAGCGTCAA
Marker sequence
TCTTAGTGCTCTGGATTTCCCTGCTCTTTCTGTGGCAGAAAGTCAAAACA
GCAGCCTAAAGTACTCTGGCAGTGATGCTCAACAAAATGTCAATCCCTAT
AGGCCTTCTGAAAAAGAGAGCACCCTTCTTTTTAGATCTGGCTCTTCCAT
CCCTTTTCGAGGTGCTACAGATTTTGCATCTGCTGTCAGGAAGATGGCAT
CTCAGGATTCTAGCATATGGAAGTATGATAGGACTGGAGTAGCTGATGGT
AGTGTTGGATCAAGTAGAAATTCACCTGTATTGGCTAGCTCTTACAATGG
TGGACAGAGTAGGGGAGTTTATGGTGATAGGTTGCAGAGCCGAGGTTCCA
CACGTGCAGCTCCTGTCTGGCTTGAAACTGGAGAAGCAGTTGCAAATATA
TATTCTGAAATGCGGGAAGAGGCTCGTGACCATGCACGCTTGCGTAATGC
ATACTTTGAACAGGCACGTCAGGCATATCTTATTGGTAACAAGGCTTTGG
CCAAAGAACTGAGCGTCAAGGGACAACTTCACAATATGCAGATGAAGGCA
GCTCATGGGAAGGCTCAAGAATCTATATATCGCCTAAGGAACCCA
Genomic location of T0720  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1562 marker 1562
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)