SGN Marker T0722

SGN-M1564
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDB63TH
Arabidopsis best BAC match: AC005287.4
Arabidopsis position: 1.0980000
Arabidopsis identities: 0.878
Best GenBank protein hit: AAD25628.1
Evalue: 2.4e-15
Identities: 0.878
Description: Hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39852)
Chromosome
1
Position
100.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0722 was used as an overgo probe on plate 3 [well G9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAGCAAGAGTGTGGAGATTGCTGG
B sequence
CTGATTCTGGGCAAACCCAGCAAT
AB sequence
TAGCAAGAGTGTGGAGATTGCTGGGTTTGC
Marker sequence
TGGAGGTGTGCGACTTGCGGTGCTGCGAAGAGTTTCTTTGATAGCAAGAG
TGTGGAGATTGCTGGGTTTGCCCAGAATCAGCAGTATGGGTTAGGTGGTA
ATACTCTTACTTCTGGCCAAAAGGCACTGCTTATATATGGTGGATTGCTT
TTGGGATTTGTGTTCTTCTTGTCTGGTTATTTCCTTCAATAAAACAGATT
ATTTGAGAAAGTTTTGAAGTTAGTATATTTGTGTTTATGTGTTTGTACAT
GTATAATAATTGTACATGGTTTAGAATGG
Genomic location of T0722  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1564 marker 1564
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)