SGN Marker T0725

SGN-M1567
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDB70TH
Arabidopsis best BAC match: AC007168.4
Arabidopsis position: 2.1270000
Arabidopsis identities: 0.846
Best GenBank protein hit: AAF07780.1
Evalue: 1.7e-13
Identities: 0.566
Description: unknown protein; 15069-22101 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49548)
Chromosome
4
Position
51.74 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47482)
Chromosome
4
Position
40.05 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42380)
Chromosome
11
Position
57.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39407)
Chromosome
4
Position
59.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10804)
Chromosome
11
Position
57.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0725 was used as an overgo probe on plate 8 [well A4]

Plausible BAC Matches:   P214E16

 Overgo Sequences

A sequence
GAAGAGTTCATTCGGGAAGGTCAC
B sequence
TCGGTCAATCTGGATCGTGACCTT
AB sequence
GAAGAGTTCATTCGGGAAGGTCACGATCCA
Marker sequence
CGCCAAACGAAGGTTGTTTCAACTGGTCCTAATCCAGAGTTCGATGAGAG
CTTTTCATGGTCCTTTGAAAGTCCTCCTAAAGGCCAGAAGCTCCATATTT
CATGCAAGAATAAGAGCAAAATGGGGAAGAGTTCATTCGGGAAGGTCACG
ATCCAGATTGACCGAGTAGTTATGCTGGGTGCAGTAGCTGGGGAGTACAC
CTTGTTGCCCGAGAGCAAAAGCGGACCCTCAAGGAATTTAGAAATAGAAT
TCCAATGGTCCAATAAGCAGCAAATGGAATAAGGTTTACTCAAACTGCAT
TTTAGTGGTATAGGAACAAATGTTTGGAACTTCTTTCGGTTTTCTGTTTC
CTTTCTTCCTGTTTAATTATAAGGTGAATGTATATAGTGTCTGGTATAGG
TGTTACTACGTTTCGATCATATTTAGTTGTTGTAACGGCTGTTGTCAATG
TATTCTTTTGTAACTTGAGTCACTTTAGTATCATCAAGGAAGGGACATGG
ATTCATGGTTTGCTTCCTTTTT
Genomic location of T0725  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1567 marker 1567
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)