SGN Marker T0732

SGN-M1573
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDC14TH
Arabidopsis best BAC match: AC006223.3
Arabidopsis position: 2.1810000
Arabidopsis identities: 0.562
Best GenBank protein hit: AAD15395.1
Evalue: 2.0e-29
Identities: 0.638
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49551)
Chromosome
9
Position
63.35 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47485)
Chromosome
9
Position
64.67 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39410)
Chromosome
9
Position
64.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0732 was used as an overgo probe on plate 15 [well F2]

Plausible BAC Matches:   P049F24

 Overgo Sequences

A sequence
TGGCACCGTCCTTTTATCTTCACC
B sequence
GGGTCTCTCTCGATAAGGTGAAGA
AB sequence
TGGCACCGTCCTTTTATCTTCACCTTATCG
Marker sequence
TGGCAGCTCAAGGAACTTGCCTTAATCACGTCTCCAGAGAATCCTCTGAT
ATCAAACGCCTAGCCCAATTTTACATTGAGATATTTGGGTTTCAGAAAGT
TGAAGCTCCAAGATTTGAATTTGATGTGATATGGTTGAAGCTGGCACCGT
CCTTTTATCTTCACCTTATCGAGAGAGACCCGACTACGAAGCTTCCAGAA
GGTCCATGGAGTGCCACGTCAGCCATCGCTGACCCGAAGAATCTGCCCAG
AGGTCACCATGTCTGCTTCACCATCTCCAATTTCGATTCCTTTGTTCAGA
AGCTCAAGGATAACGGAATTGAAGTTCATGAGAGGACTCAACCGGATGGC
AAGACCAAACAAGCCTTTTTCTTTGATCCAGATGGAAATGGTTTGGAGGT
AAGCAGTGGGGCTCCTGCCTCCTAGACAGTAGTGACCAAACTCTTGGTGT
TCCGCGTAAGTTTTAGAGTATAATAAACCCAAAGGACTCGAAAAACATTA
GCTCGAATGATGACCTTGTGTAAATTTTCGTATTGGTATGAAAATATTGT
GTCGTTTAGCT
Genomic location of T0732  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1573 marker 1573
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)