SGN Marker T0735

SGN-M1574
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TMEDF35TH
Arabidopsis best BAC match: AB005238.1
Arabidopsis position: 5.0250000
Arabidopsis identities: 0.824
Best GenBank protein hit: AAA34187.1
Evalue: 8.9e-84
Identities: 0.993
Description: phytoene synthase [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39411)
Chromosome
2
Position
77.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0735 was used as an overgo probe on plate 11 [well H3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGGGCTTATGTGAGCAAGCCAAAG
B sequence
GCAACGTCAGAAGCTTCTTTGGCT
AB sequence
AGGGCTTATGTGAGCAAGCCAAAGAAGCTT
Marker sequence
GGCATTGCACCTGAATCAAAGGCAACGACAGAGAGTGTATATAATGCAGC
TTTGGCTTTAGGGATCGCAAATCAACTAACCAATATACTCAGAGATGTAG
GAGAAGATGCAAGAAGAGGAAGAGTATACTTACCTCAAGATGAATTAGCA
CAGGCAGGGCTCTCCGATGAAGACATATTTGCTGGAAAGGTGACTGATAA
GTGGAGAATCTTTATGAAGAAGCAAATCCAGAGGGCAAGGAAATTCTTTG
ATGAGGCAGAGAAAGGTGTCACAGAACTGAGTTCTGCTAGTAGATGGCCG
GTGTTGGCATCGTTGCTGTTATATCGCAAGATACTGGACGAGATTGAAGC
AAACGACTACAACAACTTCACAAGGAGGGCTTATGTGAGCAAGCCAAAGA
AGCTTCTGACGTTGCCCATTGCTTATGCAAGATCTCTAGTGCCCCCTAAG
TCAACTTCTTCCCCACTAGCAAAGACATGAATGAAGTTTCTAAATGCCAA
TTAGAGGCCTATACATACACTAAAGAAAACAGGTACTTAATTGTAAATGA
GCTAATCTTGCTACATGTGTTTCATCATAT
Genomic location of T0735  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1574 marker 1574
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)