SGN Marker T0737

SGN-M1576
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.03
Tomato EST read: TMEDF37TH
Arabidopsis best BAC match: AB008268.1
Arabidopsis position: 5.2820000
Arabidopsis identities: 0.806
Best GenBank protein hit: CAC03600.1
Evalue: 4.2e-52
Identities: 0.880
Description: splicing factor SC35 [Arabidopsis thaliana]
Comment: pre-mRNA splicing factor
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49552)
Chromosome
4
Position
57.66 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47486)
Chromosome
4
Position
63.47 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39412)
Chromosome
4
Position
80.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0737 was used as an overgo probe on plate 6 [well H11]

Plausible BAC Matches:   P255I02

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACCGGACATCAAAGACACCTACTC
B sequence
GTTGAGAACGAGCAGAGAGTAGGT
AB sequence
ACCGGACATCAAAGACACCTACTCTCTGCT
Marker sequence
CGGCGATGTCTCACTTCGGTAGATCAGGCCCACCGGACATCAAAGACACC
TACTCTCTGCTCGTTCTCAACGTTACTTTTCGTACCACTGCTGATGACTT
GTTTCCTCTATTTGATAAGTATGGAAAAGTAGTCGATGTCTTTATCCCTA
GAGACCGAAGGACTGGAGATTCTAGGGGTTTTGCATTTGTGCGCTACAAG
TATCAGGATGAGGCTCAAAAAGCAGTGGAAAAGCTTGATGGAAGAGTTGT
AGATGGTCGGGAAATCATGGTTCGATTTGCGAAGTACGGCCCTAATGCTG
AGAGAATTGACAAAGGTAGAATTTTGGAGCCTGTACAAAGGCCAAAAGGG
AGGTCAAGAAGCCGCAGTCCTAGACCAAGGCATCGTGATCATAGGGACAA
GGATTCTAGAAGGAGAAGCCGAAGTAGAAGTAGAAGTAGAAGTAGGGGAA
GGTATGAGCGTGATCAGTACCGTGGAAGAGACAGAGATAACCGTCATCGG
AGCAGAAGCCGCAGCCCTGATTACC
Genomic location of T0737  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1576 marker 1576
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)