SGN Marker T0739

SGN-M1577
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDC49TH
Arabidopsis best BAC match: AC006434.5
Arabidopsis position: 1.1414000
Arabidopsis identities: 0.796
Best GenBank protein hit: AAF87111.1
Evalue: 2.8e-50
Identities: 0.684
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49553)
Chromosome
4
Position
62.94 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47487)
Chromosome
4
Position
117.59 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39413)
Chromosome
4
Position
128.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0739 was used as an overgo probe on plate 8 [well A2]

Plausible BAC Matches:   P331L22

 Overgo Sequences

A sequence
CAACATGTCAAGGCAGTGGCATTC
B sequence
TCAAGGTACCGAGGTTGAATGCCA
AB sequence
CAACATGTCAAGGCAGTGGCATTCAACCTC
Marker sequence
TGATGATAGCAAAATCCATAGCTAAACTAAACATTGAAAGAAAAGGGAGG
AAATGTTAACAGCACCTTCACTTTCCCGCTTTAAGTCTCCATTTATCAGC
TCACCTCTTAAGCTTCCTACTCTTTCTTCTTCTTTTTTCACTCAGAAATT
TCATCAAACATGTCGTAGGCGAAATTCGTACCCATGTATTAAAGCTGTGG
ATCTTGATCAAAACACGGTGATAGCAATTACAGTTGGGGTGCTCAGTGTT
GCTATTGGAGTTGGAATTCCAGTTTTTTATGAGACCCAAATTGATAATGC
TGCAAAAAGAGAGAACACTCAGCCCTGCTTCCCCTGCACTGGCACTGGTG
CTCAGAAATGCAGATTTTGCATGGGTACTGGCAGTGTGACGGTGGAGCTT
GGAGGGGGTGAGACAGAAGTCTCTCGGTGCATCAATTGTGACGGTGCTGG
TGGTTTGACTTGCACAACATGTCAAGGCAGTGGCATTCAACCTCGGTACC
TTGATCGCAGGGAATTCAAGGACGATGATTAGATATGGAAGAATACTCAG
CATGGATGCCACAACTTGTTTATTGTCTAGAAGACCTGTCATTTTGACCT
GAATATATTGACACAAAATTGTGTAAAATTCATTTATGTTCATCCCCTCT
CT
Genomic location of T0739  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1577 marker 1577
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)