SGN Marker T0740

SGN-M1578
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDC50TH
Arabidopsis best BAC match: AL031986.1
Arabidopsis position: 4.1830000
Arabidopsis identities: 0.717
Best GenBank protein hit: CAB81485.1
Evalue: 3.8e-40
Identities: 0.651
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39414)
Chromosome
2
Position
83.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0740 was used as an overgo probe on plate 13 [well B2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CACTGCCAGGAACAAAAGCAGATG
B sequence
CTGCTTCTCGTCCAAACATCTGCT
AB sequence
CACTGCCAGGAACAAAAGCAGATGTTTGGA
Marker sequence
CTCTGGCTGAGATGGAATACTTTACAGCAGAGATCACATCAGAGTCTACA
CCTTTTGCTATATCCCTAGCGAAACACCTGCATTCAATTGGGGCAAAAAT
GTATGGGGCTTTCTGGTGTTCTCACTGCCAGGAACAAAAGCAGATGTTTG
GACGAGAAGCAGCAAAGTTACTAGACTATGTAGAATGCTTTCCTTATGGA
CTTAAGAGGGGAATTTCTATGATCAATGCATGTCAAGAAGCAAAACTCGA
AGGGTTCCCTACATGGGTTATCAATGGGGAGGTTCTTAGCGGAGAGAAGA
AGCTTTCAGAGCTGGCTGCACTGTCTGGTTTCGATATGAAAGAAGAACTT
ACTGAGGCTAAATGAGCTCTGTTGATCAACAGTCACATACTCTTAGGATA
TCTAAGTTTATGAATTCTTATAACTGCCCTCTGGTATTTACTTAGTTTCA
TAATGTAATTACCTTCTTATGTTAGTAAAACTGAATAGGTAGTATGATAA
AGTGAAGGATCCGAGTGGATCATCTTCTGAGT
Genomic location of T0740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1578 marker 1578
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)