Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T0741

SGN-M1579
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEDC55TH
Arabidopsis best BAC match: AB025631.1
Arabidopsis position: 3.0560000
Arabidopsis identities: 0.812
Best GenBank protein hit: BAA18864.1
Evalue: 7.5e-13
Identities: 0.413
Description: hypothetical protein [Synechocystis sp.]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53150)
Chromosome
4
Position
20.93 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49554)
Chromosome
4
Position
2.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47488)
Chromosome
4
Position
16.47 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39415)
Chromosome
4
Position
20.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0741 was used as an overgo probe on plate 7 [well C7]

Plausible BAC Matches:   P062M01

 Overgo Sequences

A sequence
GGGATGACTCTGCATTTAGCGGAA
B sequence
AGAGCTGCAAGGTCTATTCCGCTA
AB sequence
GGGATGACTCTGCATTTAGCGGAATAGACC
Marker sequence
CCAGAATGACGAGTTCTCTGGGGATTCACCCTCGTATCTGCTCGTTAGGA
GGAGGTCCAGAGCATATTGTGAAGGAAAGAAGCTGCAAAATTTCATGCTT
TCGTTATACAGATGTAGAATCTTCTTGGAAAGAATTGTTTCCTTCAAAAA
TTCAGAAGTTCAATAGCTGCCGCCACCTAAATACTAGAAAATGCTGGGCA
GTTTTTTCCGCTGCAACCGGTGATGCAAATGATCCGGATGACTCAGAAGA
TAGTAAGAATCCTCCAGAAAATGAAAATGAATCCGTAAATAATGAAATTT
TAAGGGGTAATCTTGAAAGAATCGTCGGGCGGGATGACTCTGCATTTAGC
GGAATAGACCTTGCAGCTCTGATAAGGAATAAATATGGAAGGTCCTATGA
TGTTCAATTGATTAAGAAGGAATTCATGGGGAAAAATCTTCTTGCGTTAA
ACGTTATGTGGAAATACAGGGAGCAGCGATCTTTTCCGTTAACTGAAGAA
GAGTACCTACTGAGGCTAGATGATGTGGCAAACACATTGAAATGCTGGGG
AGCTGTTTCACATATTCGTAATAGCCTTGAGAAGTTGAAAGAGCGGNCTC
TGATAGGGAAGGCAGTGAGCATTTTCATCGATAT
Genomic location of T0741  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1579 marker 1579
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)