SGN Marker TG96

SGN-M158

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
Forward sequence
ACCAATGCAATATCATTTTTTATTTCTAAATAAATATATTTTTAATAATACTTTTAGTTATTTCATCTTTTATTTTACAGAAAAATACTT
TAATTTTTGAATTTATCAAAGATATTTTTGTTTTATATAATTAAAAGGATGTTATATTGGGATAATAATTATTACTATTATGGTTATATT
GTTTATGGTGGTGGTTATTATAATAAGAAAATTTTATCTACATAAATGAATTTTTACAATAAAAATTAAATAAATAAGTACTACTTAATT
AAGGGTAGCAGACATCTACAAGGTAATAATTTTTTTTTATTTGC
Reverse sequence
ATAAAAAAAGGGACAAATAAAAAAAAATTTTTACTTGGTAGAGGTCGGCTACCCTTAATTAAGAAGAACTTATTTATTTAATTTTTATGG
AAAAAATTCTTTTAGGGAGAAAAAATTTTCTTTTTATAATACCACCACCAATAAACAATATAACAATAATGGTAATAATTATTATCCCAA
TATAACATCCTTTTAATTATATAAAACAAAAATATCTTGGATAAATTCAAAAATTAAAGTATTTTTCGGGAAAATAAAAGAGGAAATACC
TAAAGGTTTTTTTAAAAATATTTTTTTTTAAAAATAAAAAAGGATATGGCATGGGTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50423)
Chromosome
5
Position
1.91 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48355)
Chromosome
5
Position
86.74 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43888)
Chromosome
5
Position
36.20 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43628)
Chromosome
5
Position
38.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43352)
Chromosome
5
Position
38.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40826)
Chromosome
5
Position
37.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40132)
Chromosome
5
Position
60.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8348)
Chromosome
5
Position
40.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8352)
Chromosome
5
Position
47.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG96 was used as an overgo probe on plate 5 [well H7]

Plausible BAC Matches:   P044E04,   P298C03,   P190E11,   P109E08

 Overgo Sequences

A sequence
TAAGTACTACTTAATTAAGGGTAG
B sequence
ACCTTGTAGATGTCTGCTACCCTT
AB sequence
TAAGTACTACTTAATTAAGGGTAGCAGACA
Marker sequence
ACCAATGCAATATCATTTTTTATTTCTAAATAAATATATTTTTAATAATA
CTTTTAGTTATTTCATCTTTTATTTTACAGAAAAATACTTTAATTTTTGA
ATTTATCAAAGATATTTTTGTTTTATATAATTAAAAGGATGTTATATTGG
GATAATAATTATTACTATTATGGTTATATTGTTTATGGTGGTGGTTATTA
TAATAAGAAAATTTTATCTACATAAATGAATTTTTACAATAAAAATTAAA
TAAATAAGTACTACTTAATTAAGGGTAGCAGACATCTACAAGGTAATAAT
TTTTTTTTATTTGC
Genomic location of TG96  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D158 marker 158
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)