Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T0753

SGN-M1584
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAL17TH
Arabidopsis best BAC match: AB019226.1
Arabidopsis position: 5.2040000
Arabidopsis identities: 0.689
Best GenBank protein hit: CAA58732.1
Evalue: 6.6e-58
Identities: 0.893
Description: mRNA inducible by sucrose and salicylic acid and potato virus Y expressed in sugar-accumulating plants. [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39419)
Chromosome
3
Position
63.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0753 was used as an overgo probe on plate 6 [well E7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCCCTTGGCATTTCTTCTGATGCT
B sequence
AACGAGACTCAAGCAGAGCATCAG
AB sequence
GCCCTTGGCATTTCTTCTGATGCTCTGCTT
Marker sequence
GTTAACAAGTTATCATAATGGCTAGCTTGAACACTTTAGCCATTGGTGCT
TTTGCACTTGCTTTCTTCGTACAAGTCACTTTAGGGGATATTGCGTGCGA
GAATTTGAATGAAGACTCTTGTGCATTTGCAATATCAAGCACGGGTAAGC
GTTGTGTTTTAGAGAAACATGTTCGTAAGAGTGGTGAAGAAGTATATATA
TTGCCGAACATCAGAAATTGAGTCTGATAAACTCAAGGATTGGATTGAAA
CTGATGAATGCCTTGAGGCGTGTGGCGTAGATAGAAACGCCCTTGGCATT
TCTTCTGATGCTCTGCTTGAGTCTCGTTNTACTAGCAAACTCTGTTCCTC
TGCTTGCTACAACANATGTCCTAACATTATTGATCTCTACTTCAATCTTG
CTGCTGGGGAAGGTGTATATCTACCCAA
Genomic location of T0753  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1584 marker 1584
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)