SGN Marker T0766

SGN-M1592
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAI63TH
Arabidopsis best BAC match: Z97339.2
Arabidopsis position: 4.0880000
Arabidopsis identities: 0.678
Best GenBank protein hit: CAB10329.1
Evalue: 5.5e-35
Identities: 0.558
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39856)
Chromosome
1
Position
138.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0766 was used as an overgo probe on plate 10 [well C4]

Plausible BAC Matches:   P156I17

 Overgo Sequences

A sequence
ATGCCACTATAGCCACAGGAGAAG
B sequence
GCTGATTTGGCCAAAGCTTCTCCT
AB sequence
ATGCCACTATAGCCACAGGAGAAGCTTTGG
Marker sequence
TGGGATTATCTTGTACAGCCTCACTCTTACTCAAAAAGCTCTTCCGCAGC
TTTGGATCTTTATCTGTTTACAGTAACATGAGAGTTCTTCAAGCTTCCAA
CATCTACGGTGTTGGTTTTGGTATTCCATCCATTTCTACTCGCCCTAACT
CTTCTTATCACCGCCATGCCACTATAGCCACAGGAGAAGCTTTGGCCAAA
TCAGCTCCAATAGGAAGAAAGTTCTCGGAGCAGCATTCTTTGAAGAAGGG
AGATATGGAGAAAGAAGGAAATTCAGTTGTTCTCGAGAAAAAAGATTTTG
CAGTTCCAAGGAGAAAGGCTATGGCCCTGATACTCTCCAGTTTTGTGCTC
TCAAATTATGAATTGCCCAAAGTTGCATATGCTCAATCTGTTGAGTTCAG
GGAATATATTGATACCTTTGATGGCTATTCGTTTATGTATCCTCGAAACT
GGATTCAAGTGCGTGGTGCTGGTGCTGACATATTTTTCAAGGATCCTCTT
GTTTTAGATGAAAATCTCTCAGTGGAGATATCATCTCCTTCATCCTCTAA
GTACAAAAGTGTAAAAGATTTGGGTCCACCAGAAGAAGCTGGAAAGGGAG
TCCTTAAACAATATTTGACTGAATTTATGTCAACTAGACTTGGTG
Genomic location of T0766  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1592 marker 1592
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)