SGN Marker T0767

SGN-M1593
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAI65TH
Arabidopsis best BAC match: AF007269.1
Arabidopsis position: 4.0080000
Arabidopsis identities: 0.814
Best GenBank protein hit: CAB80924.1
Evalue: 3.0e-37
Identities: 0.688
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49557)
Chromosome
1
Position
78.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47491)
Chromosome
1
Position
81.14 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39857)
Chromosome
1
Position
86.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0767 was used as an overgo probe on plate 8 [well C12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCATCCCGTCTTTCTGCTATTGC
B sequence
GAGAGAAGATGGGAAGGCAATAGC
AB sequence
TCCATCCCGTCTTTCTGCTATTGCCTTCCC
Marker sequence
GGAGAGGCCAAGAATCCAAGCATACTCAGTCCAAGATTCTAAAAGATTGG
CCAAATGGCAGCAGCAGCAGCAGCTTCTACTTCCATGGCGGCTACTGCCG
TCTTTGCCTCTCCTTTCCCACTTTCCTCCACCACCAAAGCTGCCCCAGCT
CGCTGCTCCGCCTTGCCTTACCTTCCATCCCGTCTTTCTGCTATTGCCTT
CCCATCTTCTCTCAAAATTGCTGAGCCCAAGAGGTCTTCGCTACTCCAGG
TCAAAGCCTCTTCATCAGAAGAATCTGGTGCTGTTGATACTAGTGAATTG
TTGACGGATCTAAAAGAAAAGTGGGATGCTCTTGACAACAAGTCTACGGT
CATAGTTTATGGAGGTGGGGCAATTGTTGCAGTTTGGCTGTCTTCAATTG
TTGTTAGGGCTATCAACTCAGTTCCTTTGCTCCCAAAAATCATGGAGTTG
GTAGGTCTTGGATATAGCGGGTGGTTTGTCTACCGCTACCTTCTCTTCAA
GTCAAGTAGAAAAGAACTGGCTGAAGATATC
Genomic location of T0767  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1593 marker 1593
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)