SGN Marker TG474

SGN-M16

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TCCTTGAGCTTTTCGTCCACCATGTTCACAGCTGATTTAATATGAGAAAATCCCTCATCAAGTAAACTCGTGATATCAATTTTATGCTGA
GAATGATAGAGGCGAAATGCCGATATTTGAGCCCGCAGCTTCTCTTCTGAAAGAATCTGCATGTTTGTCCTTTCAGTAATTAATACAAAC
ACTGGTGCTTATATTCCATTTCAGAAAAACAAAATTCGTACTTTCTGTTTTTCCAGTGCGCGCACTTTTTTCTTCAAGTGATTTTCTATT
TCAAGACCCTGAAAACCAACACAATTTTTTTTAAAAAAAAAAAAGAGAGAGAGAGAAGAGAGCATTGAAATGATTAAGAATAGAGTAGAA
CAATAAGTTCCTGCAATATTGAACAAAGAGCAGATGAGAAACTACATACTACTTGTAGCTTGTTCTGAAGATTATCCAAAGATTTTCGTA
GTGTCTCCACTTGTTCTTCCAGAGCACTCTGTCTGAGGAAAGTTAGTCAAGATCATATAATAAGTTTGAACAATTCTTTTTTATTTGATT
GACAATTAAAGAATTAAGCAGTCCACGAAAACAATTGATAGTGACTTGGAATTCCAAATTCCT
Reverse sequence
TATACAAACCATCTAAAAACAATTCTTGGAATATATGCAGTGTTACATAATATTGCCCTTATGTTCCATCTCTGATGCAGGATTGAAGAG
CTGCACTGTGAATTACTTGAAGAGAAAATATTGACGGCTACTTTGCAGAGTGAGATGGACGGGGAAGAGAGGTTGGATGAGGCTTTCAAG
GAGGTACTTAGTTCTGATGCCCTCCCTGTGAATCCATATTCATAATTGTTACAGAGCTAAAATATATAACAAAATTCTTTCATCTATACA
TGTGTAACATTCCATTTATGCAATTTTTGGATCAAGGAAGCTCTCAAAGAAATAAGAAAGAAACTATGTATTATATTCCTTCATTACTGA
TAAATATCCACCCTTGAAGATGTTGTTTTGTACAACAGGTTGTTCACAAGTTCTATGAGATCAGACAGCAGTCACTGGAGGATATTGAAG
AAGATGTGTCCTGGGAAGACAAATGTGGGTGCCTCCTGCATGATTTGTCTGAAATGTGGACTTTCAGCAATCCTGAGGAAACATCCACCT
TGAAGTACATTGTGAGTTCCAGAAAGTTAGCAATCTTAAAACTTGGACGTTACTGGTTATAACTGATGTTTTGTCTCAAATCACTTGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1707981.6e-3270 (11.1% of RFLP seq)-
SGN-U1707981.3e-54107 (17.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53335)
Chromosome
12
Position
52.35 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50397)
Chromosome
1
Position
35.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48331)
Chromosome
1
Position
136.94 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42472)
Chromosome
1
Position
133.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40058)
Chromosome
1
Position
148.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7746)
Chromosome
1
Position
146.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7744)
Chromosome
1
Position
113.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7745)
Chromosome
4
Position
31.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG474 was used as an overgo probe on plate 4 [well G12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAGAATGATAGAGGCGAAATGCCG
B sequence
CTGCGGGCTCAAATATCGGCATTT
AB sequence
GAGAATGATAGAGGCGAAATGCCGATATTT
Marker sequence
TCCTTGAGCTTTTCGTCCACCATGTTCACAGCTGATTTAATATGAGAAAA
TCCCTCATCAAGTAAACTCGTGATATCAATTTTATGCTGAGAATGATAGA
GGCGAAATGCCGATATTTGAGCCCGCAGCTTCTCTTCTGAAAGAATCTGC
ATGTTTGTCCTTTCAGTAATTAATACAAACACTGGTGCTTATATTCCATT
TCAGAAAAACAAAATTCGTACTTTCTGTTTTTCCAGTGCGCGCACTTTTT
TCTTCAAGTGATTTTCTATTTCAAGACCCTGAAAACCAACACAATTTTTT
TTAAAAAAAAAAAAGAGAGAGAGAGAAGAGAGCATTGAAATGATTAAGAA
TAGAGTAGAACAATAAGTTCCTGCAATATTGAACAAAGAGCAGATGAGAA
ACTACATACTACTTGTAGCTTGTTCTGAAGATTATCCAAAGATTTTCGTA
GTGTCTCCACTTGTTCTTCCAGAGCACTCTGTCTGAGGAAAGTTAGTCAA
GATCATATAATAAGTTTGAACAATTCTTTTTTATTTGATTGACAATTAAA
GAATTAAGCAGTCCACGAAAACAATTGATAGTGACTTGGAATTCCAAATT
CCT
Genomic location of TG474  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D16 marker 16
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)