SGN Marker T0781

SGN-M1601
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAL82TH
Arabidopsis best BAC match: AB006708.1
Arabidopsis position: 5.0370000
Arabidopsis identities: 0.773
Best GenBank protein hit: BAB09821.1
Evalue: 2.8e-33
Identities: 0.603
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49560)
Chromosome
3
Position
58.52 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47494)
Chromosome
3
Position
82.28 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39432)
Chromosome
3
Position
103.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0781 was used as an overgo probe on plate 2 [well F8]

Plausible BAC Matches:   P287M06,   P203K13,   P199O09

 Overgo Sequences

A sequence
GCGGCAACTCTCATATTGAAGCCT
B sequence
AAGCAGAGGAAAGGGAAGGCTTCA
AB sequence
GCGGCAACTCTCATATTGAAGCCTTCCCTT
Marker sequence
CTTCCACCTAACCGGATTAAACCCTCTCGGCCGGCACGGCCTCTATGGAA
AAATTTTCTCCACTATAAGAAATCAGTTCAAAATCTAGGGTTCTTTTTCT
CTATTGGAGAGAACGAATTTCATGGCGGCAACTCTCATATTGAAGCCTTC
CCTTTCCTCTGCTTTCCTCGGCCAAAAAATTTCGAGTAGAGGAAATTCGA
AGAGGTCGGAACCCTCTCGTTTGTTTTCAAAAGGTACAAAATGTGCAACG
GATACGGCTTATGGAGGTAATGTTCCGAAGTTTTCTCGATTGAATGTTTG
GGACCCTTACAAACGTCTTGGAATAAGCCGTGATGCCTCTGAGGAAGAAA
TTTGGAGTTCGCGCAACTTTTTGTTAAACCAGTATGCCAATCATGAGAGA
AGTGCAGAATCAATTGAAGCTGCTTTTGAGAAGATACTAATGAAAAGCTT
CATAAATAGAAAGAAGACAAAGATTAACTTGAAAACAAGGCT
Genomic location of T0781  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1601 marker 1601
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)