SGN Marker T0794

SGN-M1606
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 8.07
Tomato EST read: TMEBA22TH
Arabidopsis best BAC match: AB018121.1
Arabidopsis position: 3.1000000
Arabidopsis identities: 0.747
Best GenBank protein hit: BAB01986.1
Evalue: 5.7e-68
Identities: 0.747
Description: vesicle transport v-SNARE (vesicle soluble NSF attachment protein receptor) protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39434)
Chromosome
3
Position
120.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35593
Forward primer (5'-3')
CGCAAAATGGACCTAGAAGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GAGAAGCGGCAGAAATCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1600
Solanum pennellii LA716: 1600
Approximate temperature
50°C
  
PCR data   Exp. ID 48
Forward primer (5'-3')
Unknown
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1600
Solanum lycopersicum LA925: 1600
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
T0794 was used as an overgo probe on plate 2 [well D5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGAATGGCAGATGCTAACATGGTG
B sequence
GCCTTTGATCAGCAGACACCATGT
AB sequence
GGAATGGCAGATGCTAACATGGTGTCTGCT
Marker sequence
GAAGAAACAGATACTGGCTGAAATAAAAGCTGGCCTAAATGATGCTGAAG
CATTGATTCGCAAAATGGACCTAGAAGCTCGGAGTTTACCTCCAAATGTT
AAAGCCACACTTCTTGCCAAGTTGAGAGAATATAAGAGTGATCTGAACAA
CTTAAAAACTGAAGTGAAAAGAATCACATCAAGAAATGTAAACCAAGCTG
CAAGGGATGAATTGTTGGAATCGGGAATGGCAGATGCTAACATGGTGTCT
GCTGATCAAAGGCAAAGGTTGATGATGTCAACAGAGAGATTGAACCGTTC
AAGCGACAGGATCAGGGACAGTCGAAAGACAATGCTAGAAACCGAGGATC
TGGGGGTCTCAATTCTTCAAGATTTGCATCAACAACGTCAGTCTCTTCTG
CATGCACATGACACGCTTCATGGAGTGGATGATAATATTAGCAGGAGCAA
GAAGATTTTGACTACAATGTCAAGAAGGATGAGCAGGAATAAATGGATCA
TTGGCACTATCATTGGTGTCTAGGTCCTGGCTATACTATTAGTTCTTTAC
TTCAAGCTCGCCCATTAGCACAATGGATGGTTTTCAAGATTTCTGCCGCT
TCTC
Genomic location of T0794  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1606 marker 1606
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)