SGN Marker T0819

SGN-M1619
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.05.03
Tomato EST read: TMEAZ88TH
Arabidopsis best BAC match: AC005679.1
Arabidopsis position: 1.1498000
Arabidopsis identities: 0.547
Best GenBank protein hit: AAD38293.1
Evalue: 2.2e-58
Identities: 0.542
Description: putative pathogenesis related protein [Oryza sativa]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49562)
Chromosome
4
Position
55.16 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47496)
Chromosome
4
Position
54.52 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39439)
Chromosome
4
Position
70.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0819 was used as an overgo probe on plate 7 [well D8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGAAAGGGATTGACACCAGCAGAA
B sequence
CACCAAGCTTTGCAGATTCTGCTG
AB sequence
CGAAAGGGATTGACACCAGCAGAATCTGCA
Marker sequence
CACCAAATGGAGAAATGGACCTCCTACTTATGATGTTGTTGATAAGCTCT
TTGAACAAGAAAGAACTAATGTATGGGCTGAAGGATCAGTTGAAGAGAAA
GTGCAAAGGCTATTGAAGACTTGGGAAATGGAAATAGTCCATAAGGCAGA
TCCTAATGAGCTCAAAACTATGGATCCAAACAAGTTCACAATTAGTGTTA
ATGGTCGAAAGGGATTGACACCAGCAGAATCTGCAAAGCTTGGTGGTAGC
TACAATATATTCCTACAAACTTCATTACCAGAAAATGTTAGAATCTACAA
TCCTGACGATGAAACATTTGAATCATCACAAAATCTTTTTAGATCAATAT
TTTTACGCGGATTCGCGATCGAAATCCTTCATGTTTATTCAGGACCACCA
GGAATTGTTTACAAATTTAGGCATTGGGGTTACATGGATGCTCCATTTAA
AGGACATACTCCAACTGGACAACTTGTTGAGCTCTTTGGAATTGGCACTT
TTGAATTGGATAAAGAGAGTAACAAGATTGTAAAAGCAGAGATGTTTTTT
GATAGAGGAGAATTGCTTGGAGGACTTGTGAAAGGAGAAAGCAATTGTGC
GTCAACATGTCCTTTTATGAAATAAGAAGAAATTATTATTACTATGTTNT
ATTATTTTAC
Genomic location of T0819  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1619 marker 1619
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)