SGN Marker CD51

SGN-M162

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
450
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD51 image not available
Forward sequence
GAAAAGGGGATCGGAAACTTCCTCCCCGAGCTTAAACAAAAAAGATACATGAGGTGTCTCGCGGATGGAAATCTTCTGCTAACCAAGATC
CACAACATTGGTGCAACACTTGTTGGTGTGGATAAATTTGGTAACAAATATTATGAGAAGCTAGGCGATACACAATATGGAAAACACCCC
CGGGGGGGGGATGCACAGAAAAATCATTACAATGCTTCACAAGTTCCACCACAATGGCATGGGTGGGTCCATCACGTCACTGATCACACT
GGTGATGAACTGCTACTGCTGAAAC
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1469068.1e-42105 (35.6% of RFLP seq)+
SGN-U1469063.2e-78178 (60.3% of RFLP seq)+
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43629)
Chromosome
3
Position
65.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43491)
Chromosome
3
Position
47.00 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43028)
Chromosome
3
Position
50.90 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42281)
Chromosome
3
Position
74.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40727)
Chromosome
3
Position
70.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Eggplant-LXM 2002   
Map version
29 (location: 8376)
Chromosome
3
Position
90.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8375)
Chromosome
3
Position
60.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8377)
Chromosome
3
Position
68.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CD51 was used as an overgo probe on plate 14 [well D4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P131D22,   P104E07,   P269L03,   P296C12,   P272I01

 Overgo Sequences

A sequence
CATCACGTCACTGATCACACTGGT
B sequence
GCAGTAGCAGTTCATCACCAGTGT
AB sequence
CATCACGTCACTGATCACACTGGTGATGAA
Marker sequence
GAAAAGGGGATCGGAAACTTCCTCCCCGAGCTTAAACAAAAAAGATACAT
GAGGTGTCTCGCGGATGGAAATCTTCTGCTAACCAAGATCCACAACATTG
GTGCAACACTTGTTGGTGTGGATAAATTTGGTAACAAATATTATGAGAAG
CTAGGCGATACACAATATGGAAAACACCCCCGGGGGGGGGATGCACAGAA
AAATCATTACAATGCTTCACAAGTTCCACCACAATGGCATGGGTGGGTCC
ATCACGTCACTGATCACACTGGTGATGAACTGCTACTGCTGAAAC
Genomic location of CD51  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D162 marker 162
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)