SGN Marker T0825

SGN-M1623
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07
Tomato EST read: TMEBC18TH
Arabidopsis best BAC match: AC004561.2
Arabidopsis position: 2.1670000
Arabidopsis identities: 0.708
Best GenBank protein hit: AAG16758.1
Evalue: 3e-116
Identities: 0.995
Description: putative glutathione S-transferase T3 [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39440)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0825 was used as an overgo probe on plate 10 [well E7]

Plausible BAC Matches:   P155M04

 Overgo Sequences

A sequence
GAGACATGGAAGCACAATCCACTC
B sequence
AAGGATCTTCAGGGAGGAGTGGAT
AB sequence
GAGACATGGAAGCACAATCCACTCCTCCCT
Marker sequence
CAATGGCAAGTGAGAAAGTGAAATTGCTTGGATACTGGGCAAGCCCTTTT
GCTCTGAAGGTTCATTGGGCACTGAAACTGAAAGGTATTGAATATGAATA
CCAAGAAGAAGATCTCTCAAACAAAAGTCCTTTGCTCTTGCAGTACAATC
CAGTTCATAAGAAGATTCCGGTTTTGGTTCATAATGGGAAACCTATTGCA
GAATCACTAGTCATACTTGAATACATTGAAGAGACATGGAAGCACAATCC
ACTCCTCCCTGAAGATCCTTATGAAAGAGCCAAGGCGCGTTTTTGGGCAA
AATTTGTTGATGACAAGTGTGTGCCAGGAATATTTGGTACCTTTGCCAAG
GTCGGAGTGGAGCAACAGAAGATAGCAAAAGAAGCTCGTGAGAACTTGAA
AATTTTAGAGGATGAACTAGGCAAGAAGCACTTTTTTGGAGAGGCAAAAA
TTGGCTTCATGGATGTCACGTCTGCTTGGATCATCTGCTGGGCTCAGATT
GTTGAGGAGGTTGTGGATATCAGACTTATTGATGCCGAGGAAATGCCTTC
ACTTGTTTCATGGTTTCAGAATGTCCTTGAAGCTGCTCCCATTCTGAAAG
AATGTACACCGCC
Genomic location of T0825  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1623 marker 1623
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)