SGN Marker T0827

SGN-M1624
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEBC24TH
Arabidopsis best BAC match: AL049711.3
Arabidopsis position: 3.1170000
Arabidopsis identities: 0.963
Best GenBank protein hit: CAB41338.1
Evalue: 2.3e-44
Identities: 0.646
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39441)
Chromosome
11
Position
14.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39442)
Chromosome
3
Position
83.50 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0827 was used as an overgo probe on plate 3 [well G6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCCTTCAGAATCTTCCCAGATCCT
B sequence
CTCAGTGGTAAACCAGAGGATCTG
AB sequence
GCCTTCAGAATCTTCCCAGATCCTCTGGTT
Marker sequence
CCAATGAATTGCCTTCAGAATCTTCCCAGATCCTCTGGTTTACCACTGAG
AAGTTTCACAGGCAACTCAAGAAAGCTTTATTCCACTGTTGTTTCACTGG
GGATGACAAAATTTGCTGATCAGCGTCTAAGTATTGTGGCACAGGTTGTA
TCTGGTCCAGAATCTACTACAGAGAAGGATGAGGAAAAATCCGATACATA
CAGTCATGACATGACTGCAGCTATGGGAGCTGTCTTGACTTATAGGCATG
AGTTAGGAATGAACTACAACTTCATCCGTCCAGATTTGATTGTTGGGTCA
TGTCTACAGACTCCTGAGGACGTGGACAAGCTTCGGAGCATTGGAGTAAA
AACTATATTTTGCTTTGCAACAAAATCCAGATCTTGAATACTTTGGGGTT
GATATCAATGCTATTCGTGAATACGCCAACAAATGGGGTGCTATTGAACA
CTTGCGTGCCC
Genomic location of T0827  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1624 marker 1624
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)