SGN Marker T0829

SGN-M1625
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEBC27TH
Arabidopsis best BAC match: AB006697.1
Arabidopsis position: 5.0150000
Arabidopsis identities: 0.851
Best GenBank protein hit: BAB10007.1
Evalue: 1.2e-29
Identities: 0.704
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39443)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0829 was used as an overgo probe on plate 1 [well C12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCACAAGAGTCTCCAGCCAGAAAG
B sequence
CAAGCTCTGCAAACAACTTTCTGG
AB sequence
TCACAAGAGTCTCCAGCCAGAAAGTTGTTT
Marker sequence
GCAAGGAGGAAATAAGGGAGAGAGATAGTGACAAAGATGGCAAGGTTAAT
TTCAACGAGTTCTTTCACGGGCTGTTTGACTTGGTAAGAAACTATGACGA
GGAGAGTCATGATACTTCTCATCATTCTGAGGATTCACAAGAGTCTCCAG
CCAGAAAGTTGTTTGCAGAGCTTGATAAAGATGGGGATGGATATTTGTCA
GAAGCTGAATTGCTACCTATAATTGGAAAGCTTCATCCATCAGAGCGTTA
CTATGCAAAGCAACAAGCAGATTACATCATACAACAGGCTGATGCAGATA
AAGACGGAAGGCTTACTCTGAAAGAGATGATTGATAGCCCGTATGTTTTC
TATAGTGCAATATTCAATGAGGATGAAGAAGACTATGAAGACCAGGATGA
GTTCCGTTAGTTCAAGGATGGTAACACGTCTCTCCTGCCCTCAGTTACTC
GTGTATGATACTTTCCAGTTAGGTAGATGTTTGAGATTTTTATGGTGGTC
TCACCAAAAGATATATGTGGTGTGACATCAACGTTTTATTTATCAGATAG
TTTTCTTTGTAATCATCATTATTGACGAGATCATGCTAATGCATTTGCAT
ATTCAGGATCTACCATTGTTTCATTGGAAAATTTTAGTT
Genomic location of T0829  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1625 marker 1625
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)