SGN Marker TG324

SGN-M163

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CATTATATATTGTTCATAGCTTAACTCTGGTAACGTATTTGCACAAAGAAGGGGCCAGTGGAAGCAATTCCTAATGAGAGTAGAGGCAGT
AGAAGGAGTTGAAGAAATAAAGAGAAAGCAGAAAAGAGTGAAGAAAAGAAGCATGGTAAGAAGAGAGAAAAATATTAGAACTATTTTCCA
TCTTAGCAAGGGAACAAATCATTTGATGGGCTGGACTGATGCTTAACAATGATGGTGCACAAATGAGGAAAAAAGAAAACAAAAGGAGAA
AGAGTATTGCTACTGAACCTTTAGACTTAAAATACTAATACAACAGATCAGTTGCTTCTCTTTTGTCAGTTCAAAGGTTGGACTAGAAAA
GTTTGTTTAAGGGGTTAGTTTAAGAGATGTACTTTTTTCACTTGGTTGATGGATAGTGGTGATTATGAACTCGAAACCTTGAGGAAGAGG
GGGATA
Reverse sequence
AGACCAAGCATCCTTCTAGTAGTCCAACAGCAACTGATACTGCTACTCCTGTAGCCCGTAAAGGTCTATGCCCTGGCATAACCTGCGGTG
AAGAATGGATATCTTCGATTGCTGATGTGATGCTGAACTCCCCTTCTGACAGTGGTATCAGGAATCCCTGTTTTGGAGCCATATGTACCA
TTCCTGCTTGGTACTTCATACGATGAATACCCAGGAGTTGCTTGGTCTGTGATTAAAGAAAAAATAGCAAAATGAACAAATAAAGCACAA
TCCATAATGAGTTTCTAGATGTTGCTGTTGATGCATTTTATTGTGTTGGTGGGCCGTGGGGGATTGGGAAGGGGTAATCCGGACCACAGA
ACAGGTTACTCAAGGTAGCTTACTTTAAATTGAATGGTTAAACCTGCATGAAGCGACTTTTTATTACTATTTCATTTTCCTTATGGTTCA
GAATATTGATTAGTGAATTGGTCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39995)
Chromosome
3
Position
4.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8378)
Chromosome
3
Position
3.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35631
Forward primer (5'-3')
CACTTGGTTGATGGATAGTG
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1200
Mg+2 concentration
3mM
Reverse primer (5'-3')
CTTCTAGTAGTCCAACAGCAACTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 38
Forward primer (5'-3')
Unknown
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1200
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG324 was used as an overgo probe on plate 2 [well E4]

Plausible BAC Matches:   P214K01,   P317K14,   P203C09,   P181H07

 Overgo Sequences

A sequence
GCCAGTGGAAGCAATTCCTAATGA
B sequence
TCTACTGCCTCTACTCTCATTAGG
AB sequence
GCCAGTGGAAGCAATTCCTAATGAGAGTAG
Marker sequence
CATTATATATTGTTCATAGCTTAACTCTGGTAACGTATTTGCACAAAGAA
GGGGCCAGTGGAAGCAATTCCTAATGAGAGTAGAGGCAGTAGAAGGAGTT
GAAGAAATAAAGAGAAAGCAGAAAAGAGTGAAGAAAAGAAGCATGGTAAG
AAGAGAGAAAAATATTAGAACTATTTTCCATCTTAGCAAGGGAACAAATC
ATTTGATGGGCTGGACTGATGCTTAACAATGATGGTGCACAAATGAGGAA
AAAAGAAAACAAAAGGAGAAAGAGTATTGCTACTGAACCTTTAGACTTAA
AATACTAATACAACAGATCAGTTGCTTCTCTTTTGTCAGTTCAAAGGTTG
GACTAGAAAAGTTTGTTTAAGGGGTTAGTTTAAGAGATGTACTTTTTTCA
CTTGGTTGATGGATAGTGGTGATTATGAACTCGAAACCTTGAGGAAGAGG
GGGATA
Genomic location of TG324  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D163 marker 163
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)