SGN Marker T0852

SGN-M1634
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEBC71TH
Arabidopsis best BAC match: AB010697.1
Arabidopsis position: 5.0120000
Arabidopsis identities: 0.812
Best GenBank protein hit: BAB11160.1
Evalue: 1.5e-39
Identities: 0.815
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49564)
Chromosome
1
Position
79.46 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47498)
Chromosome
1
Position
88.83 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39446)
Chromosome
1
Position
93.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0852 was used as an overgo probe on plate 9 [well A7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P316N21,   P050P19,   P234D05,   P080J18,   P320K06,   P329B17

 Overgo Sequences

A sequence
CAAAGACACAGTCTCGTCCGATTC
B sequence
TTGAAGCCCGAACTCTGAATCGGA
AB sequence
CAAAGACACAGTCTCGTCCGATTCAGAGTT
Marker sequence
TCAGATTTCTACTAGTGGTTCTGCTTCTTCATCACTTCAATATACTACCT
AAAAGACACCAACATAGTTGGGCTACAAGCAAATTTGTAAGATAATGGCT
TGTGCTGCTTTATCAGCAAACAGCTGCACCATAGCTTCATCGTCTACTGG
ACGATTGAGCTTTTCCACATACCAAAAGGACTCAAAATTGAGGCAAAGAC
ACAGTCTCGTCCGATTCAGAGTTCGGGCTTCAACTGACGATTCTGATTGC
AATGCTGAAGAATGTGCCCCAGACAAGGAGGTTGGGAAGGTGAGCATGGA
ATGGGTAGCCATGGACAACACCAAAGTGGTTGGTACATTTCCACCTCGTA
AGCCGCGTGGCTGGACAGGGTATGTTGAGAAGGATACTGCTGGGCAGACA
AATATATACTCTGTTGAGCCTGCAGTTTATGTAGCAGAAAGTGCTATAAG
CTCTGGTACTGCAGGCACCTCATCTGATGGAGCAGAGAACACCAAAGCTA
TTTCAGCTGGGATAGCCTTAATCTCTGTTGCAGCTGCTTCATCGATTCTC
CTTCAAGTTGGGAAGAACTCACCTTCTCCGATACAAACAGTGGAGTACAA
GGGACCATCCC
Genomic location of T0852  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1634 marker 1634
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)