SGN Marker T0861

SGN-M1638
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAM12TH
Arabidopsis best BAC match: AC007797.7
Arabidopsis position: 1.0446000
Arabidopsis identities: 0.826
Best GenBank protein hit: AAG12544.1
Evalue: 7.6e-38
Identities: 0.694
Description: Unknown Protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49566)
Chromosome
4
Position
62.79 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47500)
Chromosome
4
Position
116.29 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39447)
Chromosome
4
Position
127.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0861 was used as an overgo probe on plate 8 [well B1]

Plausible BAC Matches:   P111P03

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCGAGAACAGAAGGACGAGTTTGC
B sequence
ATCAACTCGTCGAGGAGCAAACTC
AB sequence
TCGAGAACAGAAGGACGAGTTTGCTCCTCG
Marker sequence
TGGGAGGCTTGGTCATCGAGAACAGAAGGACGAGTTTGCTCCTCGACGAG
TTGATGTTTTTACACGGCAGAATGTCTTGCCTCCAGATGCAATAGTTTCA
GCAGGTTCTGCCAGCTCATCATGTACTGCCGGAGGAGGGCAGCTTTACAT
GTGGGGAAAAATTAAGAGCACAGGAGATGATTCGATGTATCCCAAACCTC
TTCTGGATTTGAGTGGGTGGAACCTCCGATGTATGGATTCTGGCTATATG
CACCACTTTGTTGGTGCTGATTCCTCTTGCATAAGTTGGGGCCTTGCACA
GTGTGGGGAGCTGGGTTATGGACCACATGGACAGAAATCTTCTGCAGTTC
CTAAGAAGGTGGACATTTTAGATGGCATGCATGTTATCAGTGTTGCTTGT
GGATTTGCCCACTCCATGGTTGTTATTGATAGGACACATGTTGAGGATCG
ACTTGAGCAGCTTGATGTATATGATGGCAAGGCTTCTGAGGAAGTGGGGG
CAAAATCCTGTGAGTGAATCTCC
Genomic location of T0861  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1638 marker 1638
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)