SGN Marker TG252

SGN-M164

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1610
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG252 image not available
Forward sequence
AGCCAGTGTCACTTTTATTTTGCTTTCACTTTTTGATTCATGACCATTAAATCTCTCTTTATCCTGTCCGATAAAAGGATAATCGGAAAC
AGAAAATCTACCTTTGCTTTTCTATTTTTCTAATAATAAAAAAAATTCAATCACTTTTCTTTGATTTTATTATAGAAGGCAAAGAAGAAA
AATTCCAAAAAAATTTATAAGTAAGAGAAGAAGTCGCATTATTGTTGTGATGTGAGAGCTATCGGCTATTGAAAAGAACTTTATGATTTG
GATAAACTATAAGTTATGTCCAAATCAATGTTATGTTCCTATCTTTAATTTCCTTTGCTTCTTAAAATATACTTAAAAAAGTCAATTCGT
GCAATACTTGTATAACATGGACACGAAATTATGTGCCAGTATTTTTTTATATACGCCAATCTATACAGCTAACGTTTATTTCTTATCTTC
CTTTCCCTTT
Reverse sequence
CATCTGAACCATCCTTTGATTCCAAAGCTTCCTTCTCTACTTTTATAAACTCTCCGTCAAAAGCAGACTCTTCGTGCTCCGTCTGACCTA
TCTCGCCATTGGACACCTGTAATAAGATGTAATCCAAACAGAAGATGAGGAAGAAGAATAAGAATTTCTTAGCCAGTATATTCAAATATA
TTTTACTGAACTTTAAACCAGGTAAATTACAAAAATGATTTACTTGAAATTAAGCAAATTTTTCGCCATAGTTGATGTATTAAATGTGCA
GTGAGTAGAAAAAACAAAGATTGTCATAGACTATTTATTTATCGCATCATATTTGACAAAAGTGCCGTAAATTCATGTTATCGTTTCCAG
TGCCACCACTCCCTAGTTACATCTAAAACGTTGAATCCATAATCACTTTAAACCGAATTTCCTACCTTAGTTGGATTCTACACAATTGTG
TTTTAAATCAAAAAGTTTTCTTGAAAAAAACTCCTATAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1705681.6e-56118 (24.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53526)
Chromosome
7
Position
34.66 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39963)
Chromosome
7
Position
31.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8380)
Chromosome
7
Position
26.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35625
Forward primer (5'-3')
GCCAGTGTCACTTTTATTTTGC
Digested band sizes (using AluI)
Solanum pennellii LA716: 400+600
Solanum lycopersicum LA925: 500+600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GCTCCGTCTGACCTATCTCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 90
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum pennellii LA716: 400+600
Solanum lycopersicum LA925: 500+600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG252 was used as an overgo probe on plate 9 [well E4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAAGAAGTCGCATTATTGTTGTG
B sequence
CCGATAGCTCTCACATCACAACAA
AB sequence
AGAAGAAGTCGCATTATTGTTGTGATGTGA
Marker sequence
AGCCAGTGTCACTTTTATTTTGCTTTCACTTTTTGATTCATGACCATTAA
ATCTCTCTTTATCCTGTCCGATAAAAGGATAATCGGAAACAGAAAATCTA
CCTTTGCTTTTCTATTTTTCTAATAATAAAAAAAATTCAATCACTTTTCT
TTGATTTTATTATAGAAGGCAAAGAAGAAAAATTCCAAAAAAATTTATAA
GTAAGAGAAGAAGTCGCATTATTGTTGTGATGTGAGAGCTATCGGCTATT
GAAAAGAACTTTATGATTTGGATAAACTATAAGTTATGTCCAAATCAATG
TTATGTTCCTATCTTTAATTTCCTTTGCTTCTTAAAATATACTTAAAAAA
GTCAATTCGTGCAATACTTGTATAACATGGACACGAAATTATGTGCCAGT
ATTTTTTTATATACGCCAATCTATACAGCTAACGTTTATTTCTTATCTTC
CTTTCCCTTT
Genomic location of TG252  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D164 marker 164
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)