SGN Marker T0876

SGN-M1647
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TMEAO48TH
Arabidopsis best BAC match: AC002986.1
Arabidopsis position: 1.1499000
Arabidopsis identities: 0.839
Best GenBank protein hit: CAA65231.1
Evalue: 2.3e-64
Identities: 1.000
Description: PSII polypeptide [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39872)
Chromosome
5
Position
12.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0876 was used as an overgo probe on plate 11 [well E4]

Plausible BAC Matches:   P179K09,   P257O04,   P277K22,   P309N01,   P336E15

 Non-Plausible BAC matches

P007L06,   P073A07,   P108K06,   P215P04

 Overgo Sequences

A sequence
CAGTCCCATCTACAACACGGATGA
B sequence
ACCACTTGGAGACCATTCATCCGT
AB sequence
CAGTCCCATCTACAACACGGATGAATGGTC
Marker sequence
CAGTAATGAGCTCATTGAGCCTAAAGCCAACTTTCACTCTGGAGAAAATA
TCAGTGAAAGGGCTTCCATCACTTACTAGATCTTCTTCTTCCTTCAAAGT
TGTGGCTAGTGGTGTTAAGAAGCTTAAGACTGACAAACCCTATGGAATTA
ATGGAAGCATGGCCTTGAGAGATGGGGTTGATGCCTCAGGCAGGAAGCCC
AAGGGAAAGGGTGTGTACCAATATGTTGACAAATATGGAGCTAATGTTGA
TGGATACAGTCCCATCTACAACACGGATGAATGGTCTCCAAGTGGTGATG
TCTATGTTGGAGGTACCACTGGCTTAGCCATATGGGCGGTGACCTTGCTT
GGCATTCTTGCAGGAGGTGCTCTCCTTGTCTACAACACAAGTGCTTTGGC
GCAATAGATGTTATCCTTGTATTGTACTATTAAGTTTAAGTTGTATTCCA
TGTTATCTTTTCAAAATATTTCTTGGCATCTTCATTAATATGTAATTGCT
GTGATTTTACTGTGGATAATATTACATCTAATGGTGCTGTTTT
Genomic location of T0876  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1647 marker 1647
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)