SGN Marker T0877

SGN-M1648
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAM49TH
Arabidopsis best BAC match: AC022314.5
Arabidopsis position: 1.0854000
Arabidopsis identities: 0.714
Best GenBank protein hit: AAF79680.1
Evalue: 1.2e-34
Identities: 0.641
Description: unknown protein; [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49568)
Chromosome
4
Position
54.50 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47502)
Chromosome
4
Position
50.49 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42399)
Chromosome
4
Position
61.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39449)
Chromosome
4
Position
67.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10993)
Chromosome
4
Position
40.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0877 was used as an overgo probe on plate 6 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATTCCAGGCTGTCAGGCTCTTGG
B sequence
AATCTTGCTGGAGGGCCCAAGAGC
AB sequence
TATTCCAGGCTGTCAGGCTCTTGGGCCCTC
Marker sequence
GTTGAAATGGATAGAAAATAGAGAGAAGAAGAGAGGATGAATTTGTCATG
AGTCCATGGCCACTCGCTTTGCTCCTTCTTCTTACATTCATAGTTGTCAA
CTTAAGCATTCAACTACACCTGCTGTTCTTCTTAATTCTTTTAGTGGAAG
AAAACCCCCTTACAACACACTTGTATTCCAGGCTGTCAGGCTCTTGGGCC
CTCCAGCAAGATTCGAAGCTTCAAAGCTGGAAGTCTTGTTAAAAGGAGAA
GAAGTTGATACATACTCAAGTATCGTGCCAAGGACGTACACATTATCCCA
TTGTGATTTTACTGCTAATCTGACATTAACAATCTCAAATAATATCCAAT
ACGATCAGTTGAAAGGGTGGTATAATAAAGATGACGTGGTTGCTGAATGG
ACAGAAGTGAAAGGTAATTTGTTTCTTGATGTCCACTGTTATGTGAGTGG
ACCGAATCCCCTACAAGAGCTAGCTGCCGAGTTCAGATACCATATATTCT
CCAA
Genomic location of T0877  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1648 marker 1648
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)