SGN Marker CT157

SGN-M165

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
not available
Reverse sequence
CACCCAGGTAGCACTAAGTGCTTCTGGTCTTGAATGGATAACCTGGGTGCCTGCAAATGCCACAAGAAGATGTCTCAATGAGAAGGATGA
ACTGGGAAATGTTAGAACGGTTAAAGATTTGAACATGGGCGTTGCTAATGTTCCAGAGCTCGAAGGCCTATCAGGTAAAGTTATGGATGG
TTTAGCAGCTTCTATGAAGGACAAACATTTGGAGTTAGATCCTAAAGATAATGAGAATATGGGTAGAAACCTAAAGCTGAACAAGGAAAC
ACGGGAAGATGACCTGAAGGACAAGGATGTTGGTTATATGGGTGACATAACCAACACATGTACGCCTCAAGTAGAAAGTACTGCCAATGA
AGTTCCAAATGATCCTTCCAAGATCACAAACATCAAAGAAATTGCCACCTATGACAGTAAAGACATGCCTTCACTTGAACTTAGTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1464455.9e-1947 (10.5% of RFLP seq)-
SGN-U146445406 (91.0% of RFLP seq)-
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43637)
Chromosome
4
Position
55.50 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43499)
Chromosome
4
Position
35.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43037)
Chromosome
4
Position
54.50 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42304)
Chromosome
11
Position
59.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40741)
Chromosome
4
Position
48.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38983)
Chromosome
4
Position
56.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8384)
Chromosome
11
Position
60.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8383)
Chromosome
4
Position
38.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8388)
Chromosome
4
Position
34.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT157 was used as an overgo probe on plate 8 [well F5]

Plausible BAC Matches:   P234F13,   P099A10,   P063A22,   P314A17,   P029F16

 Overgo Sequences

A sequence
AGGAAACACGGGAAGATGACCTGA
B sequence
CCAACATCCTTGTCCTTCAGGTCA
AB sequence
AGGAAACACGGGAAGATGACCTGAAGGACA
Marker sequence
CACCCAGGTAGCACTAAGTGCTTCTGGTCTTGAATGGATAACCTGGGTGC
CTGCAAATGCCACAAGAAGATGTCTCAATGAGAAGGATGAACTGGGAAAT
GTTAGAACGGTTAAAGATTTGAACATGGGCGTTGCTAATGTTCCAGAGCT
CGAAGGCCTATCAGGTAAAGTTATGGATGGTTTAGCAGCTTCTATGAAGG
ACAAACATTTGGAGTTAGATCCTAAAGATAATGAGAATATGGGTAGAAAC
CTAAAGCTGAACAAGGAAACACGGGAAGATGACCTGAAGGACAAGGATGT
TGGTTATATGGGTGACATAACCAACACATGTACGCCTCAAGTAGAAAGTA
CTGCCAATGAAGTTCCAAATGATCCTTCCAAGATCACAAACATCAAAGAA
ATTGCCACCTATGACAGTAAAGACATGCCTTCACTTGAACTTAGTT
Genomic location of CT157  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D165 marker 165
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)