SGN Marker T0883

SGN-M1653
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.10
Tomato EST read: TMEAO63TH
Arabidopsis best BAC match: AC009526.4
Arabidopsis position: 1.0840000
Arabidopsis identities: 0.728
Best GenBank protein hit: AAF63121.1
Evalue: 3.6e-42
Identities: 0.669
Description: Putative histidine decarboxylase [Arabidopsis thaliana]
Comment: not well characterized role in plants
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49570)
Chromosome
4
Position
55.66 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47504)
Chromosome
4
Position
54.29 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39873)
Chromosome
4
Position
70.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0883 was used as an overgo probe on plate 7 [well E9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGTCGTCCTTTTCTGTTACGGAAC
B sequence
TCATCATCCGCATCAGGTTCCGTA
AB sequence
CGTCGTCCTTTTCTGTTACGGAACCTGATG
Marker sequence
ATTTTCCGATCGTTCCTTAGCCGACGCTGCCGGTTCTCCGTTTACAGAAA
TCTCCATTGTTTCCAAGTGATTGTTGATTCGAACAGAGCTATGGTAGGAA
CAAGTGCAGTAATCGAATCGATGGGTTCAGCTGTTAATGGAAAGGAGGTG
GCGGATGTTCGATTTGATCCGACGGCTGTAGTACCGGAGCTGGTGCCTGC
AGTGGTGAAATCGGAAGTAGATGCGGCGGTTAATGGCGGTGGCCAGGAGC
AGAAGAGGGAGATAGTGTTAGGGAGGAATATACATACGTCGTCCTTTTCT
GTTACGGAACCTGATGCGGATGATGATTCTACTGGTGATAAGGAAGCGTA
TATGGCTAGTGTTCTAGCTCGGTATAGGAAGACTCTCACTGATCGAACTA
AGTATCATTTAGGGTATCCATATAATTTGGATTTCGATTATGGTGCACTC
ACACAATTGCAGCATTTCTCCATCAATAACTTATGAGATCCATTCATTGA
GAGCAAC
Genomic location of T0883  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1653 marker 1653
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)