SGN Marker T0892

SGN-M1657
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07
Tomato EST read: TMEAW49TH
Arabidopsis best BAC match: AL163972.1
Arabidopsis position: 3.1196200
Arabidopsis identities: 0.653
Best GenBank protein hit: CAA32643.1
Evalue: 1.3e-89
Identities: 0.928
Description: manganese superoxide dismutase preprotein (AA -24 to 204) [Nicotiana plumbaginifolia]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39875)
Chromosome
6
Position
14.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35597
Forward primer (5'-3')
TGGCTCTTCGGACTTTAGTGA
Digested band sizes (using TaqI)
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACCTTCTGCGTTCATCT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 78
Forward primer (5'-3')
Unknown
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0892 was used as an overgo probe on plate 4 [well C4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P155N18,   P244G21,   P319D16,   P032G03,   P244E20,   P162I07,   P203E24,   P298K09,   P195N06,   P162O13,   P317H02,   P298P09

 Overgo Sequences

A sequence
GAACAGCTCCATGATGCCATCTTC
B sequence
CAGGAGCATCTCCTTTGAAGATGG
AB sequence
GAACAGCTCCATGATGCCATCTTCAAAGGA
Marker sequence
AATGGCTCTTCGGACTTTAGTGAGCAGACGGACCTTAACGGCAGGGCTAG
GGTTCCGCCAACAACTTCGTGGCGTTCAAACCTTTTCGCTCCCCGATCTC
CCATACGACTATGGCGCCCTGGAGCCGGCAATTAGCGGTGATATAATGCA
GCTCCACCACCAGAAGCATCATCAGACTTACATCACTAATTACAATAAGG
CCCTTGAACAGCTCCATGATGCCATCTTCAAAGGAGATGCTCCTGCCGTC
GCCAAATTGCACAGTGCCCTCAAATTTAACGGCGGAGGTCATATTAATCA
CTCAATTTTCTGGAATAACCTTGCCCCTGTCAGCGAAGGTGGTGGGGAGC
CTCCAAAGGGTTCTCTTGGCTGGGCTATTGACACTAACTTTGGTTCACTG
GAAGCTTTAGTAAAAAAGATGAACGCAGAAGGTGCTGCTTTACAGGGCTC
TGGCTGGGTGTGGCTTGGTGTGGACAAAGAGCTTAAGCGCCTTGTGGTTG
AAACC
Genomic location of T0892  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1657 marker 1657
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)