SGN Marker T0896

SGN-M1660
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAP71TH
Arabidopsis best BAC match: AL031394.1
Arabidopsis position: 4.1720000
Arabidopsis identities: 0.866
Best GenBank protein hit: CAB80084.1
Evalue: 2.1e-50
Identities: 0.814
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49574)
Chromosome
1
Position
86.10 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47508)
Chromosome
1
Position
131.34 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39876)
Chromosome
1
Position
143.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0896 was used as an overgo probe on plate 9 [well E8]

Plausible BAC Matches:   P183G03

 Overgo Sequences

A sequence
CAATGGCAGTTCAGACATTGCAGC
B sequence
TTGCCCAGTGATCGGAGCTGCAAT
AB sequence
CAATGGCAGTTCAGACATTGCAGCTCCGAT
Marker sequence
AGATAGGAGTATTTTGATGAAATATCAACTCACATTTGTCATCTTCTTAT
TGAAGCAGAAGAGTATCTTTCACATTTCAAAGCCCTAATATTTACATCAA
TGGCAGTTCAGACATTGCAGCTCCGATCACTGGGCAACACTGGACTCAAA
CTCAGCTCTGTCGGCTTCGGCGCTTCGCCTCTCGGCAAGGTTTTCGGCGA
TGTCTCCGAACAAGACGCCTTCGACGCCGTCCGGGAAGCCTTTCGCCTCG
GTGTCAATTTCTTTGATACTTGCCCGTATTATGGAGGAACATTATCGGAA
AAGGTACTAGGGAAAGCTTTGAAGGCTCTTAAAGTCCCTAGAGATCAGTA
CATTGTGTCTACAAAATGTGGGAGGTACAAAGAGGGATTTGATTTTAGTG
CTAAGAGAGTGACTAAAAGTATTGATGAGAGCTTGGAGAGGCTGCAGCTT
GATTATGTTGATATGTTACAATGTCATGATATTGAATTTGGGTCCCTTGA
TCA
Genomic location of T0896  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1660 marker 1660
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)