SGN Marker TG253

SGN-M167

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CGTCGAAGAGGGATTTGACTTGATTTGGATCGGAGACATTGGCTTTGACGGCGATTGCGCGTGGGGAATCGGAGGTGGAATTGATTTGGG
ATACGACGTCGTCAGCTTGAGTAGAGTTGGAAGTGTAGTTGATGACGAGTTTAGCTCCGAGAGAGGCCAAGTGAAGAGCAATTGCTTTGC
CGATTCCGCGAGAAGAGCCGGTAACAATGGCTACACGATTCCCGAGGCTTTGGCCTTGGGCTACGTTTGTTTCCGCCATGATCACTGAAG
AAAAGCACTGAAATTGCTAGAAAATGGAATTTTGTGGATAAACAAACGAAAAGTGCTGGTGTGGTGCTAAATGTGTGATAATATTTAATA
CTCATAACAAATAATTAAAAGAGGAGAAAAAGTTCAAAATAGTCTCTTTATCTTCTATTAAGAATTAAAATCATATTTGAATTCTCACAC
AAATTATAATAGTTCCTCATG
Reverse sequence
AAAAGAAGACCAACATCTCAGATTTTATTTTAAAATATAAATTTTTTAAAGACAATAGATTATCAAAATTGCAAGAACCACAATTTCATG
CTAATTTTTATGATTTTGTTTTATGTTTATAAATATGTAATTTCTAAATTGTATTTAAGAGCTAATTTTGCTGTTTGGAGTTTTATCTAT
TTTCAAATCATCATTTTCATTTTCTTAAATATATTTGTTTACCTTATTTATCATTTTTAACTTGGTCCAAAATATAAATAAATACTATAT
GTTATCTGAATTTATGACTTCCTATATTACTTTTTTTTAATCATTTATTAAAAGTTTTATATTTGTGATAAGATTAACTTATGTTTTAGT
TATTTCTTTAAATTTGAAGATGTTTCTTTCCCAAATATAGCAGACATATGAAGTATCTCCATTTAAAATTTTTGTCCTACAGTGTCGAGC
GATTTATTTGACTATGACCAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1696723.7e-1495 (20.2% of RFLP seq)+
SGN-U1464812.8e-64219 (46.5% of RFLP seq)+
SGN-U146482325 (69.0% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53527)
Chromosome
6
Position
50.82 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50360)
Chromosome
6
Position
40.05 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48294)
Chromosome
6
Position
61.92 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43850)
Chromosome
6
Position
64.20 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43593)
Chromosome
6
Position
54.70 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43311)
Chromosome
6
Position
66.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40849)
Chromosome
6
Position
63.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39964)
Chromosome
6
Position
55.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8395)
Chromosome
6
Position
52.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG253 was used as an overgo probe on plate 4 [well B9]

Plausible BAC Matches:   P125P18

 Non-Plausible BAC matches

P006P14,   P270O04,   P119G11

 Overgo Sequences

A sequence
GGTGGAATTGATTTGGGATACGAC
B sequence
TACTCAAGCTGACGACGTCGTATC
AB sequence
GGTGGAATTGATTTGGGATACGACGTCGTC
Marker sequence
CGTCGAAGAGGGATTTGACTTGATTTGGATCGGAGACATTGGCTTTGACG
GCGATTGCGCGTGGGGAATCGGAGGTGGAATTGATTTGGGATACGACGTC
GTCAGCTTGAGTAGAGTTGGAAGTGTAGTTGATGACGAGTTTAGCTCCGA
GAGAGGCCAAGTGAAGAGCAATTGCTTTGCCGATTCCGCGAGAAGAGCCG
GTAACAATGGCTACACGATTCCCGAGGCTTTGGCCTTGGGCTACGTTTGT
TTCCGCCATGATCACTGAAGAAAAGCACTGAAATTGCTAGAAAATGGAAT
TTTGTGGATAAACAAACGAAAAGTGCTGGTGTGGTGCTAAATGTGTGATA
ATATTTAATACTCATAACAAATAATTAAAAGAGGAGAAAAAGTTCAAAAT
AGTCTCTTTATCTTCTATTAAGAATTAAAATCATATTTGAATTCTCACAC
AAATTATAATAGTTCCTCATG
Genomic location of TG253  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D167 marker 167
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)