SGN Marker T0953

SGN-M1678
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAV18TH
Arabidopsis best BAC match: AB017069.1
Arabidopsis position: 5.0930000
Arabidopsis identities: 0.822
Best GenBank protein hit: BAA83585.1
Evalue: 2.0e-91
Identities: 0.807
Description: Similar to Caenorhabditis elegans cosmid D1054; hypothetical protein (Z74030) [Oryza sativa]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39877)
Chromosome
4
Position
49.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0953 was used as an overgo probe on plate 9 [well C4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAAGTTGACCATGTGGAACCATGG
B sequence
GACAGTTGCCAGTCATCCATGGTT
AB sequence
CAAGTTGACCATGTGGAACCATGGATGACT
Marker sequence
TCATGAAGTGATTGATGAAATCTATAATCAAGTTGACCATGTGGAACCAT
GGATGACTGGCAACTGTCGTGGTCCTTCAACAGCCTTCTGCCTTCTCTAC
AAGTTCTTCACAATGAAACTTACTGTCAAGCAAATGCATGGCCTGTTAAA
GCATCCAGATTCTCCTTACATTAGAGCTATTGGGTTCCTTTATCTGAGAT
ATCTTGGTGATTTTAAGACATTATGGGGTTGGTATGAGCCTTACCTCAAA
GATGATGAGGAATTCTCTCCTGGATCCAGTGGGCAAATGACCACAATGGG
TGTATATGTGCGTGACTTATTTCTCGGGCAGTATTATTTTGACACACTAC
TACCCCGCATTCCTGTTCCTGTCGTGCGGACAGCAGTTGCCAGTCTCGAA
AAAATGAATCTGCCGACCAAACTTTCTGGGTCGATTGGCGATTCTAGTCG
TGGATCTGAGGAAACTTCTCGCCGGCCACCTTCTGTCAAAGCTTCCCTTT
CAGTGTCCTTTGGTCAGCGGGCACCTCATCGTGCATCAACTAGAGATTCA
TCTCCCATCCGAAGAACAATNGCACCACCATCCTATGATAA
Genomic location of T0953  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1678 marker 1678
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)