SGN Marker T0954

SGN-M1679
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAV13TH
Arabidopsis best BAC match: AC005662.2
Arabidopsis position: 2.2240000
Arabidopsis identities: 0.622
Best GenBank protein hit: AAC78535.1
Evalue: 1.5e-58
Identities: 0.645
Description: "putative embryo-abundant protein [Arabidopsis thaliana]/ 2nd,e-41, embryo-abundant protein [Picea glauca]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39878)
Chromosome
4
Position
56.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0954 was used as an overgo probe on plate 7 [well C8]

Plausible BAC Matches:   P303H13,   P308B07

 Overgo Sequences

A sequence
TGGGATGTTGGTACTGGTAGTGGC
B sequence
AAGATTGAGCAGCCTGGCCACTAC
AB sequence
TGGGATGTTGGTACTGGTAGTGGCCAGGCT
Marker sequence
TTGCTTCTAAAACACCTTCTCATGATCTTGTTTGGGATGTTGGTACTGGT
AGTGGCCAGGCTGCTCAATCTTTAGCTAAGCTTTACAAGAATGTGATAGC
TACAGACACAAGTCCAAAGCAGCTTGAATTTGCAGCAAAGGTTCCAAATG
TTCAATACATATGTACCTCTCCTAAGTTGTCAAAATCCGAAATCGAAACA
AAAATAGGATCAGAATCAAGTGTAGATTTAGTAACAATTGCACAAGCAAT
GCATTGGTTTGATCTACCAACTTTTTATGAACATGTTAAATGGTTACTCA
AGAAACCAAATGGTGTTATAGCATCATGGTGTTACACTACACCTAAAATA
AACAACTCAGTAGATGCAATATTTGATAAATTTTACACAAGTGATGCTGG
ACCTTATTGGGAATCACCAAGAAAATTGGTCGATGAAAAGTATGAAACTA
TTGATTTTCCATTTGAGGCTATAGATGGATGTGATCATAATGG
Genomic location of T0954  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1679 marker 1679
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)