SGN Marker T0958

SGN-M1682
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAU34TH
Arabidopsis best BAC match: AB010077.1
Arabidopsis position: 5.1130000
Arabidopsis identities: 0.682
Best GenBank protein hit: BAB10014.1
Evalue: 3.9e-46
Identities: 0.910
Description: GTP-binding protein LepA homolog [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39879)
Chromosome
4
Position
51.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0958 was used as an overgo probe on plate 9 [well A2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGCGAGGCAATATCTGCTATCAGG
B sequence
TGGCGAGAACATCCTTCCTGATAG
AB sequence
AGCGAGGCAATATCTGCTATCAGGAAGGAT
Marker sequence
TAAATGGTGATCGTGTCGAACCCTTGGCAACAATCGTACATAAAGATAAG
GCATATTCTGTGGGAAGGGCTTTAACCCAAAAGCTGAAAGAACTTATACC
CAGACAAATGTTTAAAGTACCAATTCAGGCAACCATTGGCTCAAAAGTGA
TTGCCAGCGAGGCAATATCTGCTATCAGGAAGGATGTTCTCGCCAAGTGC
TATGGTGGTGACATCTCGAGAAAAAAGAAACTGCTCAAGAAACAGGCTGA
AGGAAAGAAAAGGATGAAAGCCATTGGTAAAGTTGATGTACCACAGGAAG
CATTCATGGCTGTATTAAAACTTGAAAAAGAGGTCTTATAATTCATTTTG
TTAGTAAAGATTTTTACCGTACATCCTACCCTCGTCAGACCCTATTGGGT
TCGCGGGCAAAATGCAGTAAAGAAAGTGGGGACTACATTGATTCTGATAT
AAATATCATGTGAATAGCTGTATGACCTGNGATTTTTTTAATTTTCTTTT
TGAGTTTTTTGCATTATTTCAAACACAGCATTAATGAATAGCTAATTCAG
ATTGAG
Genomic location of T0958  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1682 marker 1682
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)