SGN Marker T0965

SGN-M1686
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07.03
Tomato EST read: TMEAU44TH
Arabidopsis best BAC match: AC009513.2
Arabidopsis position: 1.1270000
Arabidopsis identities: 0.804
Best GenBank protein hit: AAF06058.1
Evalue: 5.8e-74
Identities: 0.819
Description: Identical to gb|AF121355 peroxiredoxin TPx1 from Arabidopsis thaliana [Arabidopsis thaliana]
Comment: possibly involved in H2O2 detoxification
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39884)
Chromosome
7
Position
23.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0965 was used as an overgo probe on plate 8 [well E1]

Plausible BAC Matches:   P036A03,   P224F23,   P041K06,   P150B09,   P289N20,   P293I23,   P047J15

 Overgo Sequences

A sequence
GACCGTCTCAGTATACTCACTTGC
B sequence
GACCTTCTTGCCCTTAGCAAGTGA
AB sequence
GACCGTCTCAGTATACTCACTTGCTAAGGG
Marker sequence
TGGCTCCAATCGCCGGTGGTGACGTCATCCCCGATGGTACCGTATCTTAC
TTCGACGAGCAAGATCAGATGCAGACCGTCTCAGTATACTCACTTGCTAA
GGGCAAGAAGGTCATCATCTTCGCCGTTCCCGGAGCTTTCACTCCCACTT
GCAGCATGAAGCATGTGCCTGGCTTTATTGAAAAGGCTGCTGAGTTGAAG
TCAAAGGGTGTCGATGAAATCCTCTGCATCAGTGTCAATGACCCCTTTGT
GATGAAGGCCTGGGCAAAAACTTACCCTGAGAACAAACATGTAAAATTTC
TTGCTGATGGAGCTGGAAAATACACCCATGCCCTTGGGCTGGAGCTTGAT
CTGTCGGATAAGGGGCTTGGTGTTCGATCACGAAGGTATGCTCTTTTGGT
TGATGACCTTGAGGTGAAAGTAGCTAACATTGAATCTGGAGGGGAGTTCA
CGGTCTCTCGTGCTGATGAAATCGGCAATGCTCTTTAAGCTTATCAC
Genomic location of T0965  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1686 marker 1686
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)