SGN Marker TG182

SGN-M169

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1010
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG182 image not available
Forward sequence
GAAGAAATGAAATCTAATGATTAAGCTTGCTCGGGCAACAGTGAACTAAACAAACACAGAAACAAATATTTGATGGCATAGACAAACCGA
AAAAGAATGAAGCATGAAATATATTTTGGCCTTGACCTTTAAAAGATGAAGTTAATTGTATGACAGAATAAAGATATACTGCTTTTCTAA
ATACCAACTTGGCTTCCTTAATGTTCTGTCCAGAAGGAATAAGCAACAAATCATCTACCATACAGAACATCACACACGACACACCTAAAT
CAAGGAAAAAGAACAGAACTCTATGAGCAGCTTGTTTTGCCTGCTTGAATAGGATTTTTGAGTAACCAAGTTCTGGTTTTTCATTTGCTT
AGCAAAAGAGCAAGGGAATAGCAGATGAACAG
Reverse sequence
CATTGTAAGTATTTTCTGAATGGTTTACTCTGGAAAAGTAAATTTTCAGTAGAATATTAAAAAATTCTGTTCAATGTGGGTTTAATCTGA
CAGCTTCTTGCTTGGTAATTAGGAAATTTGTCGTCTCAAGCATGCCTTTGTTAACACTGTTTTCCTTTCACTTTGTAGGACCATCTTTAT
TTTCCTTCTCTCACTTGTTGGTGTTTTCTATCCATACAACCGTGGAGCTTTATTCACGGCACTGGTCGTCATATATGCTCTCACATCTGG
TATTGCAGGCTATACTGCTGCCTCTTTCTATTGCCAGCTAGAAGGGACAAACTGGGTTTGTTTTCTTCTCTCTGTTATATTGCATTTCCA
GTTGAATATAGTTTGAGAATTTTATCTACCGTACTAACGTCAAAACCCCTAATTCTGAATATTTGCTTGCTGTCATCCCATAAGAAGGGA
AAATGCTTTGATTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1511725.3e-81159 (34.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53521)
Chromosome
4
Position
43.62 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39929)
Chromosome
4
Position
46.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8407)
Chromosome
4
Position
35.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8408)
Chromosome
4
Position
32.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 14099
Forward primer (5'-3')
TTTTCTGAATGGTTTACTCTGGAA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTATGGGATGACAGCAAGCA
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG182 was used as an overgo probe on plate 7 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGAACTCTATGAGCAGCTTGTTT
B sequence
CCTATTCAAGCAGGCAAAACAAGC
AB sequence
CAGAACTCTATGAGCAGCTTGTTTTGCCTG
Marker sequence
GAAGAAATGAAATCTAATGATTAAGCTTGCTCGGGCAACAGTGAACTAAA
CAAACACAGAAACAAATATTTGATGGCATAGACAAACCGAAAAAGAATGA
AGCATGAAATATATTTTGGCCTTGACCTTTAAAAGATGAAGTTAATTGTA
TGACAGAATAAAGATATACTGCTTTTCTAAATACCAACTTGGCTTCCTTA
ATGTTCTGTCCAGAAGGAATAAGCAACAAATCATCTACCATACAGAACAT
CACACACGACACACCTAAATCAAGGAAAAAGAACAGAACTCTATGAGCAG
CTTGTTTTGCCTGCTTGAATAGGATTTTTGAGTAACCAAGTTCTGGTTTT
TCATTTGCTTAGCAAAAGAGCAAGGGAATAGCAGATGAACAG
Genomic location of TG182  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D169 marker 169
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)