SGN Marker T0974

SGN-M1690
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAV63TH
Arabidopsis best BAC match: AC007508.2
Arabidopsis position: 1.0615500
Arabidopsis identities: 0.583
Best GenBank protein hit: BAB16426.1
Evalue: 2.4e-74
Identities: 0.826
Description: elicitor inducible gene product EIG-I24[Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49576)
Chromosome
4
Position
61.68 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47510)
Chromosome
4
Position
100.46 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39886)
Chromosome
4
Position
110.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0974 was used as an overgo probe on plate 6 [well G5]

Plausible BAC Matches:   P269I23,   P107G05

 Overgo Sequences

A sequence
CCGCCTTTCACAGAAAACCATGTC
B sequence
TATGGGAGAGAGGAAGGACATGGT
AB sequence
CCGCCTTTCACAGAAAACCATGTCCTTCCT
Marker sequence
GGAAGTAACTACCGGCGAAACTAACACAATCTATCCATCTAAGCCGCCTT
TCACAGAAAACCATGTCCTTCCTCTCTCCCATATTGACACCGATCGGAAC
CTCAATTTCACTTTCCGATACCTCCGTGTCTACGTCAATGACGACACCAC
ATCAGACCCATATGAAGTTGTCACCTCCTCCCTCTCCGCCGCTCTCGTCC
ACTACTACCAATTCGCCGGCTCTCTCCGCCGTCGTCCATCGGACAACCGT
CTAGAGCTTCACTGTCAAGTGGGGGATGGCGTTCCCGTAATTCCGTCGAC
GGTGGATTGTACCTTGGCTTCAATGAACTACCTGGATGATCCGGATTATA
ACTTGGCTGAGAAGCTGGTACCCGACCCGAGAGATGAGGAGGCGTTGACC
CGACCCTTGATTTTGCAAGTGAACCGTTTTAAGTGTGGTGGGTGGGTTTT
CGGAACGGCGGTTCATCACGCCATGTGTGATGG
Genomic location of T0974  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1690 marker 1690
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)