SGN Marker T0984

SGN-M1694
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAZ28TH
Arabidopsis best BAC match: AC007060.2
Arabidopsis position: 1.0642000
Arabidopsis identities: 0.913
Best GenBank protein hit: AAF65513.1
Evalue: 9e-120
Identities: 0.976
Description: GTP-binding protein [Capsicum annuum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39887)
Chromosome
2
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0984 was used as an overgo probe on plate 10 [well H1]

Plausible BAC Matches:   P212L16,   P097I09,   P006N09,   P306N14,   P264J07,   P002C20,   P005F04

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCTAATGAAGCTCGAGTGCACGTT
B sequence
CAAAACGCTCATCAGGAACGTGCA
AB sequence
CCTAATGAAGCTCGAGTGCACGTTCCTGAT
Marker sequence
CAAAATCCAAAACCCTAAGCTCTTCACCACATCAAGTTTCTGTCCATTTC
CCAATTTCTCAGTTATGCCACCAAAAGCAGCTAAAGGTAAAGAAGTTCCT
GCCGAAAGGCCGATTCTTGGCCGTTTCTCATCCCACTTGAAAATTGGAAT
CGTAGGATTACCCAATGTGGGGAAGTCTACTCTCTTCAACACACTGACAA
AGTTATCCATTCCGGCAGAAAACTTTCCTTTTTGTACTATTGAGCCTAAT
GAAGCTCGAGTGCACGTTCCTGATGAGCGTTTTGAATGGCTCTGTCAACT
TTACAAGCCCAAGAGTGAGGTGGCTGCCTTTTTGGAAATTCATGACATAG
CTGGACTTGTTCGAGGTGCTCATGCAGGACAAGGATTGGGGAACAGTTTC
TTATCCCACATCCGCGCAGTTGACGGCATTTTCCATGTTCTACGCGCATT
TGAAGATCCAGATATTATCCATGTTGATGACACTGTTGATCCTGTGAGAG
ACTTAGAGGTTATAAGTGAGGAACTAAGGCTTAAGGACATCGAGTTCATG
GAGAGAAGGATAGAAGATCTTGATAAGAGTATGAAGAGAAGCAATGACAA
ACAATTGAAAATAGAGCATGAATTATGTCTAAGGGTCAAAGCATCACTCC
AGGAAGGCAAAGATGTTCGTCTGGGGGACTGGAAAGCTGCAGATGTTGAA
TTCTTGAATACCTT
Genomic location of T0984  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1694 marker 1694
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)