SGN Marker T0989

SGN-M1696
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.1
Tomato EST read: TMGAC96THB
Arabidopsis best BAC match: AC007323.5
Arabidopsis position: 1.0010000
Arabidopsis identities: 0.915
Best GenBank protein hit: AAB86803.1
Evalue: 1.1e-83
Identities: 0.914
Description: pyruvate dehydrogenase E1 alpha subunit [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49577)
Chromosome
12
Position
2.68 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47511)
Chromosome
12
Position
38.95 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39888)
Chromosome
12
Position
36.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0989 was used as an overgo probe on plate 4 [well B8]

Plausible BAC Matches:   P004L23,   P060N10,   P316H01,   P270M23,   P015A04,   P029E19,   P317I07,   P032K07,   P084O03,   P158J05,   P275A03,   P189A22

 Non-Plausible BAC matches

P076G01,   P002D12,   P266F09,   P284H17,   P012K20,   P329E17,   P236D19

 Overgo Sequences

A sequence
GAGCACAACGTTCTTGGTGGTTTC
B sequence
CCTCACCAATGAAAGCGAAACCAC
AB sequence
GAGCACAACGTTCTTGGTGGTTTCGCTTTC
Marker sequence
AAATGTTTGGTTTTGTGCATTTGTACAACGGCCAAGAGGCAGTCTCTACT
GGGTTCATTAAGCTACTGAAGAAGGAGGATTCTGTGGTTAGCACTTATCG
TGATCACGTCCATGCATTGAGCAAAGGGGTTCCAGCACGTCAAGTGATGA
GCGAGCTCTTTGGGAAGACCACTGGCTGTTGCAGAGGCCAGGGTGGCTCC
ATGCACATGTTCTCTAAAGAGCACAACGTTCTTGGTGGTTTCGCTTTCAT
TGGTGAGGGTATCCCTGTGGCAACAGGTGCCGCCTTCACTAGCAAGTATA
GAAGGGAGGTCATGAAAGAGGCAGATTGTGATCATGTAACTATGGCCTTC
TTTGGTGATGGAACTTGCAACAATGGCCAGTTCTTTGAGTGTTTGAACAT
GGCTGCTCTTTGGAAATTGCCCATTATATTTGTTGTTGAGAACAATTTGT
GGGCAATTGGAATGTCTCACTTGAGATCTACTTCAGATCCCTGAAATT
Genomic location of T0989  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1696 marker 1696
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)