SGN Marker T0998

SGN-M1700
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.01
Tomato EST read: TMGBZ28TH
Arabidopsis best BAC match: AC006200.2
Arabidopsis position: 2.0020000
Arabidopsis identities: 0.704
Best GenBank protein hit: AAF07815.1
Evalue: 7.2e-82
Identities: 0.884
Description: putative receptor protein kinase; 32634-29927 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40816)
Chromosome
5
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36565
Forward primer (5'-3')
TGGCTCCTGATGAGAAACT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CTAGGTGATGGTTGCCCATT
Digested band sizes (using XbaI)
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39890)
Chromosome
5
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0998 was used as an overgo probe on plate 12 [well B3]

Plausible BAC Matches:   P211K01,   P273L19,   P041C24,   P257L24,   P302G16,   P197K14,   P093H07,   P026H05

 Overgo Sequences

A sequence
TCCAATGGCAACTTGGCTTCTGCT
B sequence
CATTTCTCCCGTGAAGAGCAGAAG
AB sequence
TCCAATGGCAACTTGGCTTCTGCTCTTCAC
Marker sequence
TTTTAGCTTTGAGCTTGATGAGCTGTTGAGGGCTTCTGCTTATGTATTGG
GAAAGAGTGGGTTGGGGATAGTGTACAAGGTTGTGCTTGGGAACGGTATC
CCAGTGGCAGTGAGGAGATTAGGGGAAGGTGGGGAACAGAGATATAAGGA
GTTTGTAGCTGAGATTCAGGCAATCGGAAGGGTTAAGCATCCTAATGTTG
TGAAGTTAAGAGCTTATTATTGGGCTCCTGATGAGAAACTTCTCATTAGT
GATTTCATTTCCAATGGCAACTTGGCTTCTGCTCTTCACGGGAGAAATGG
GCAACCATCACCTAGTTTAACATGGTCAACGAGACTGAAAATTGCTAAGG
GAACAGCGCGAGGTTTAGCCTATCTCCATGAGTGTAGCCCAAGGAAATTT
GTCCATGGAGACGTCAAACCTTCCAATATTCTCCTTGATACTGAACTGCA
GCCATATATATCTGATTTTGGGCTCAATCGATTAATCAATATCACGGGAA
AACAACCCCTCCTCTTCTGGGTGGATTTTATGGGGTGGA
Genomic location of T0998  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1700 marker 1700
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)